• lithari 7:06 pm on 19/07/2018 Μόνιμος σύνδεσμος  

    Τεχνικός Κανονισμός για τον καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου…Ποικιλίες αμπέλου:… Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο…

     

     

    Ποικιλίες αμπέλου: Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο

    Ποικιλίες αμπέλου: Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο

    Δημοσιεύτηκε σε ΦΕΚ ο Τεχνικός Κανονισμός για τον καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου. 

    PHGH

    Σκοπός

    α) Η συμμόρφωση προς την οδηγία 2004/29/ΕΚ της Επιτροπής, της 4ης Μαρτίου 2004, για καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου (ΕΕ L 71, 10.3.2004 σ. 22).

    β) Ο καθορισμός της διαδικασίας εγγραφής των βελτιωμένων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό Κατάλογο ποικιλιών καλλιεργουμένων φυτικών ειδών της παρ. 1 του άρθρου 6 του ν. 1564/1985 (Α’ 164).

    γ) Ο καθορισμός της διαδικασίας εγγραφής των εγχώριων αβελτίωτων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό Κατάλογο.

    Δείτε αναλυτικά ολόκληρο τον Τεχνικό Κανονισμό και τους σχετικούς πίνακες ΕΔΩ.

    ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΒΛΑΣΤΙΚΑ ΣΤΑΔΙΑ

    1.1. Ημερομηνίες εμφανίσεως βλαστικών σταδίων Οι ημερομηνίες εμφανίσεως των βλαστικών σταδίων ορίζονται κατόπιν συγκρίσεως με μία ή περισσότερες από τις ακόλουθες ποικιλίες μάρτυρες. 
    1.1.1. ποικιλίες λευκών σταφυλιών – Σαββατιανό (Savatiano), Ζουμιάτικο (Zoumiatiko), Βηλάνα (Vilana), Ασύρτικο (Assyrtiko), Chardonnay.

    1.1.2. ποικιλίες μαύρων σταφυλιών – Μανδηλαριά (Mandilaria), Ξυνόμαυρο (Xynomavro), Cabernet Sauvignon, Κορινθιακή (Korinthiaki).

    1.1.3. ποικιλίες επιτραπέζιων σταφυλιών – Ραζακί (Razaki), Cardinal, Iτάλια (Italia), Σουλτανίνα (Soultanina), Perlette.

    1.2. Ημερομηνία εκπτύξεως Ημερομηνία κατά την οποία εκπτύσσεται πλήρως το ήμισυ των οφθαλμών ενός πρέμνου κανονικά κλαδευμένου και φαίνεται ο εσωτερικός τους χνοασμός σε σχέση με τις ποικιλίες μάρτυρες.

    1.3. Ημερομηνία πλήρους ανθήσεως Ημερομηνία κατά την οποία, για ένα σύνολο φυτών, το ήμισυ των ανθέων είναι ανοικτά συγκρινόμενο με τις ποικιλίες μάρτυρες.

    1.4. Ωριμότης (όσον αφορά τις οινοποιήσιμες ποικιλίες και τις επιτραπέζιες ποικιλίες). Επιπροσθέτως της περιόδου ωριμότητος εξετάζονται η πυκνότης ή ο πιθανός βαθμός του γλεύκους, η οξύτης του και η αντίστοιχη απόδοση σεσταφυλές εκφραζομένη σε χιλιόγραμμα ανά αντίστοιχο εκτάριο σε σύγκριση με μιά ή περισσότερες ποικιλίες μάρτυρες που έχουν δώσει κατά το δυνατό αποδόσεις της αυτής τάξεως μεγέθους.

    1.5. Ημερομηνία φυλλόπτωσης

    2. ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΚΑΛΛΙΕΡΓΕΙΑΣ

    2.1. Ζωηρότης: παρατήρηση κατά την άνθηση και μετά την φυλλόπτωση. Οπτική εκτίμηση του μήκους και της διαμέτρου των κύριων βλαστών. Μέση τιμή 10 βλαστών κοντά στον κορμό. (Κωδικός OIV 351).

    2.2. Τρόπος μορφώσεως (θέση του πρώτου καρποφόρου οφθαλμού, προτιμώμενο κλάδεμα): (Κωδικός OIV 155).

    2.3. Παραγωγή 2.3.1. κανονικότης.

    2.3.2. απόδοση:

    Α) Ποικιλίες: Μετράται η απόδοση της ποικιλίας (κιλά/ στρ.) σε σύγκριση με μια ή περισσότερες ποικιλίες μάρτυρες. (Κωδικός OIV 504). Β) Υποκείμενα: Μετράται η απόδοση σε μοσχεύματα ανά στρέμμα (Κωδικός OIV 551).

    2.3.3. ανωμαλίες: Μικροραγία (Κωδικός OIV 222), ανθόροια (ποσοστό καρπόδεσης, Κωδικός OIV 501), ανισοραγία (Κωδικός OIV 222).

    2.4. Ανθεκτικότης ή ευαισθησία (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.4.1. σε δυσμενείς συνθήκες: χλώρωση από έλλειψη σιδήρου (OIV 401), αλατότητα (OIV 402), ξηρασία (OIV 403).

    2.4.2. σε επιβλαβείς οργανισμούς: περονόσπορος (OIV 452-1), ωίδιο (OIV 455-1), βοτρύτις (OIV 458-1), ευτυπίωση (OIV 460), φυλλόβιος φυλλοξήρα (OIV 461), ριζόβιος φυλλοξήρα (OIV 462).

    2.4.3. πιθανή ευαισθησία στη σχάση των ραγών.

    2.5. Συμπεριφορά κατά τον αγενή πολλαπλασιασμό (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.5.1. εμβολιασμός (OIV 552).

    2.5.2. πολλαπλασιασμός με μοσχεύματα (OIV 553)
     

    PHGH

    ========================================================

    ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ

    ΤΗΣ ΕΛΛΗΝΙΚΗΣ ∆ΗΜΟΚΡΑΤΙΑΣ

    16 Ιουλίου 2018                                ΤΕΥΧΟΣ  ΔΕΥΤΕΡΟ                               Αρ. Φύλλου 2816

    ΑΠΟΦΑΣΕΙΣ

    Αριθμ. 1649/89081

    Τεχνικός Κανονισμός για τον καθορισμό των χα-

    ρακτηριστικών και των ελαχίστων προϋποθέσε-

    ων για τον έλεγχο ποικιλιών αμπέλου (Vitis L.) σε

    συμμόρφωση προς την Οδηγία 2004/29/ΕΚ, (ΕΕ L

    71, 10.03.2004, σ. 22) και άλλες εθνικές διατάξεις.

    Ο ΥΦΥΠΟΥΡΓΟΣ

    ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΤΡΟΦΙΜΩΝ

    Έχοντας υπόψη:

    1. Τις διατάξεις:

    α) των άρθρων 6 παρ. 3 και 3α, 10 παρ. 3, 14 παρ. 3

    και 27 παρ. 3 του ν. 1564/1985 «Οργάνωση παραγωγής

    και εμπορίας του πολλαπλασιαστικού υλικού φυτικών ει-

    δών» (Α’ 164), όπως η παρ. 3α του άρθρου 6 προστέθηκε

    με την παρ. 1 του άρθρου 16 του ν. 4351/2015 (Α’ 164).

    β) του άρθρου 62 παρ. 2 περ. α’ του ν. 4235/2014 «Διοι-

    κητικά μέτρα, διαδικασίες και κυρώσεις στην εφαρμογή

    της ενωσιακής και εθνικής νομοθεσίας στους τομείς των

    τροφίμων, των ζωοτροφών και της υγείας και προστα-

    σίας των ζώων και άλλες διατάξεις αρμοδιότητας του

    Υπουργείου Αγροτικής Ανάπτυξης και Τροφίμων» (Α’32),

    όπως η παρ. 2 τροποποιήθηκε με την παρ. 2 του άρθρου

    46 του ν. 4384/2016 «Αγροτικοί Συνεταιρισμοί, μορφές

    συλλογικής οργάνωσης του αγροτικού χώρου και άλλες

    διατάξεις» (Α’78).

    γ) του άρθρου 90 του Κώδικα νομοθεσίας για την Κυ-
    βέρνηση και τα κυβερνητικά Όργανα, όπως κυρώθηκε

    με το άρθρο πρώτο του π.δ. 63/2005 «Κωδικοποίηση

    της νομοθεσίας για την Κυβέρνηση και τα κυβερνητικά όργανα» (Α’ 98).

    1. Την αριθμ. 11226/133908/30.11.2016 απόφαση του

    Πρωθυπουργού και του Υπουργού Αγροτικής Ανάπτυ-

    ξης και Τροφίμων «Ανάθεση αρμοδιοτήτων στον Υφυ-

    πουργό Αγροτικής Ανάπτυξης και Τροφίμων Βασίλειο

    Κόκκαλη» (Β’ 3903), όπως τροποποιήθηκε με την αριθμ. 638/128269/30.11.2017 (Β’ 4250) όμοια απόφαση.

    1. Την γνώμη της Τεχνικής Επιτροπής Πολλαπλασια-

    στικού Υλικού (Τ.Ε.Π.Υ.) του άρθρου 20 του ν. 1564/1985

    (Α’ 164), όπως έχει τροποποιηθεί και ισχύει, όπως αυτή δι-

    ατυπώνεται στα από 6.3.2018 πρακτικά συνεδρίασής της.

    1. Το γεγονός ότι από τις διατάξεις της απόφασης

    αυτής δεν προκαλείται δαπάνη σε βάρος του Κρατικού προϋπολογισμού, αποφασίζουμε:

    Σκοπός της απόφασης αυτής είναι:

    Άρθρο 1

    Σκοπός

    α) Η συμμόρφωση προς την οδηγία 2004/29/ΕΚ της

    Επιτροπής, της 4ης Μαρτίου 2004, για καθορισμό των

    χαρακτηριστικών και των ελαχίστων προϋποθέσεων για

    τον έλεγχο ποικιλιών αμπέλου (ΕΕ L 71, 10.3.2004 σ. 22).
       β) Ο καθορισμός της διαδικασίας εγγραφής των βελ-

    τιωμένων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό κα-

    τάλογο ποικιλιών καλλιεργουμένων φυτικών ειδών της παρ. 1 του άρθρου 6 του ν. 1564/1985 (Α’ 164) (στο εξής Εθνικός Κατάλογος).

    γ) Ο καθορισμός της διαδικασίας εγγραφής των εγ-

    χώριων αβελτίωτων ποικιλιών αμπέλου (Vitis L.) στον

    Εθνικό Κατάλογο.

    Άρθρο 2

    Επίσημοι έλεγχοι

    (άρθρο 1 της οδηγίας 2004/29/ΕΚ)

    1. Οι επίσημοι έλεγχοι που διεξάγονται για την αποδο-

    χή των ποικιλιών αμπέλου της παρούσας απόφασης είναι

    Δοκιμές Διακριτότητας – Ομοιομορφίας – Σταθερότητας

    (Δοκιμές Δ.Ο.Σ.) και διενεργούνται από το Τμήμα Ελέγχου

    Ποικιλιών Καλλιεργουμένων Φυτών (Τ.Ε.Π.Κ.Φ.) της Διεύ-

    θυνσης Πολλαπλασιαστικού Υλικού Καλλιεργούμενων

    Φυτικών Ειδών και Φυτογενετικών Πόρων του Υπουρ-

    γείου Αγροτικής Ανάπτυξης και Τροφίμων. Σε ό,τι αφο-
    ρά την ομοιομορφία, η ποικιλία θεωρείται ομοιόμορφη

    όταν ο αριθμός των αποκλινόντων φυτών δεν υπερβαίνει

    το 1% των εξεταζόμενων φυτών (ομοιομορφία 99,0% με

    πιθανότητα 95%, δηλαδή 0 αποκλίνοντα φυτά σε σύνολο

    5 εξεταζόμενων πρέμνων ή 1 αποκλίνον φυτό σε σύνολο

    24 εξεταζόμενων πρέμνων).

    1. Οι δοκιμές της παρ. 1 διαρκούν τρία (3) συνεχόμενα

    έτη. Οι ποικιλίες αμπέλου προτείνονται για εγγραφή στον

    Εθνικό Κατάλογο Ποικιλιών Καλλιεργούμενων Φυτικών
    Ειδών εφόσον πληρούνται τα κριτήρια των δοκιμών για

    την Διακριτότητα, την Ομοιομορφία και την Σταθερό-

    τητα του μέρους Α και εφόσον δεν επαρκούν και του

    μέρους Β του παραρτήματος I του άρθρου 5.

    36040                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    1. Τα ελάχιστα χαρακτηριστικά του φυτού των υπο-

    ψήφιων για εγγραφή ποικιλιών της αμπέλου που εξε-

    τάζονται στις δοκιμές Δ.Ο.Σ. αναφέρονται στα μέρη Α

    και Γ του παραρτήματος I του άρθρου 5. Τα πρόσθετα

    χαρακτηριστικά που εξετάζονται στις δοκιμές Δ.Ο.Σ.

    αναφέρονται στα μέρη Β και Δ του ίδιου παραρτήματος.

    1. Οι ελάχιστες προϋποθέσεις για την πραγματοποίηση

    των επίσημων ελέγχων αναφέρονται στο παράρτημα II του άρθρου 5.

    Άρθρο 3

    Διαδικασία εγγραφής

    βελτιωμένων ποικιλιών αμπέλου

    1. Για να καταχωριστεί μια ποικιλία αμπέλου της περ. β’ του άρθρου 1 στον Εθνικό Κατάλογο,

    α) ο δημιουργός της ποικιλίας ή ο διατηρητής της ποι-

    κιλίας ή ο νόμιμος εκπρόσωπος του δημιουργού που

    έχει την έδρα του ή την κατοικία του στην Ε.Ε. και έχει

    ορισθεί με εξουσιοδότηση του δημιουργού ή του δια-

    τηρητή, υποβάλλει στο Τ.Ε.Π.Κ.Φ. ειδική έντυπη αίτηση
    που χορηγείται από το Τ.Ε.Π.Κ.Φ. συνοδευόμενη από:

    αα) πληροφοριακά στοιχεία σε ειδικό έντυπο που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ., τα οποία δίνουν την κατά το δυνατόν πληρέστερη περιγραφή της ποικιλίας και των αγρονομικών συνθηκών κάτω από τις οποίες πρέπει να γίνει η επίσημη εξέταση της ποικιλίας.

    ββ) αντίγραφο πιστοποιητικού φυτικής δημιουργίας

    ή αντίγραφο κοινοτικού δικαιώματος επί φυτικής ποικι-
    λίας, εφόσον υπάρχει.

    γγ) δήλωση του δημιουργού ότι είναι δημιουργός της ποικιλίας.

    δδ) βεβαίωση του δημιουργού ότι η ποικιλία δεν είναι/

    είναι γενετικά τροποποιημένη.

    εε) εξουσιοδότηση του δημιουργού για τον ορισμό

    διατηρητή.

    στστ) δήλωση του διατηρητή ότι διατηρεί την ποικιλία

    και τη χώρα διατήρησης.

    ζζ) αποδεικτικά πληρωμής των προβλεπόμενων για

    την άμπελο τελών δοκιμής, όπως αυτά αναφέρονται

    στην αριθμ. 6321/44913/30.4.2015 απόφαση του Ανα-

    πληρωτή Υπουργού Παραγωγικής Ανασυγκρότησης,

    Περιβάλλοντος και Ενέργειας «Καθορισμός τελών δο-

    κιμής παραβόλων για την υποβολή αίτησης εγγραφής

    ποικιλιών καλλιεργούμενων φυτικών ειδών στον Εθνικό

    Κατάλογο» (Β’ 1099).

    β) διενεργούνται οι επίσημοι έλεγχοι του άρθρου 2

    για να διαπιστωθεί ότι η ποικιλία αμπέλου πληροί τις

    απαιτήσεις της παρ. 1 του άρθρου 6 της αριθμ. 258676/

    29.9.2003 απόφασης (Β’ 1517).

    1. Κατά παρέκκλιση της περ. β’ της παρ. 1, δεν διε-

    νεργούνται οι επίσημοι έλεγχοι του άρθρου 2 εφόσον

    υπάρχει πιστοποιητικό φυτικής δημιουργίας του άρθρου

    8 του ν. 1564/1985 ή κοινοτικό δικαίωμα επί φυτικής

    ποικιλίας αμπέλου, σύμφωνα με τον Κανονισμό (ΕΚ) αριθ.

    2100/94 (ΕΕ L 227, 1.9.1994, σ.1). Στην περίπτωση αυτή,

    η αίτηση της περ. α’ της παρ. 1 υποβάλλεται από τον

    κάτοχο του πιστοποιητικού φυτικής δημιουργίας ή του

    κοινοτικού δικαιώματος επί φυτικής ποικιλίας ή από τον

    εξουσιοδοτημένο εκπρόσωπό του, μαζί με την επίσημη

    περιγραφή της ποικιλίας συμπεριλαμβανομένων και των

    χαρακτηριστικών που αναφέρονται στο παράρτημα I του

    άρθρου 5, τα οποία τυχόν δεν περιλαμβάνονται στην

    επίσημη περιγραφή και όλα τα σχετικά έγγραφα χορή-

    γησης του πιστοποιητικού φυτικής δημιουργίας ή του

    κοινοτικού δικαιώματος επί φυτικής ποικιλίας. Το τέλος

    που καταβάλλεται στην περίπτωση αυτή, ορίζεται στο

    15% του τέλους δοκιμής που καταβάλλεται κατά έτος

    ή καλλιεργητική περίοδο για την άμπελο, σύμφωνα με

    την αριθμ. 6321/44913/30.4.2015 απόφαση. Το ανωτέρω

    τέλος καταβάλλεται μία φορά.

    1. Η αίτηση της περ. α’ της παρ. 1 παραλαμβάνεται σε

    ημερομηνίες καθορισμένες από το Τ.Ε.Π.Κ.Φ., καταχωρί-

    ζεται σε ειδικό μητρώο ποικιλιών και τηρείται φάκελος

    με τον αριθμό μητρώου της ποικιλίας, ο οποίος περι-

    λαμβάνει τη σχετική αλληλογραφία, τα δεδομένα των

    πειραμάτων των δοκιμών Δ.Ο.Σ. και όλα τα στοιχεία για την υποψήφια για εγγραφή ποικιλία.

    1. Για τη συνέχιση των δοκιμών Δ.Ο.Σ. για το δεύτερο

    έτος απαιτείται η υποβολή ειδικής έντυπης αίτησης που

    χορηγείται από το Τ.Ε.Π.Κ.Φ., δήλωση του τελικού ονό-

    ματος της ποικιλίας και αποδεικτικά πληρωμής των προ-

    βλεπόμενων για την άμπελο τελών δοκιμής της αριθμ. 6321/44913/30.4.2015 απόφασης.

    1. Για τη συνέχιση των δοκιμών Δ.Ο.Σ. για τρίτο έτος

    απαιτείται η υποβολή ειδικής έντυπης αίτησης που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ και τα αποδεικτικά πληρωμής των προβλεπόμενων για την άμπελο τελών δοκιμής της αριθμ. 6321/44913/30.4.2015 απόφασης.

    1. Ο αιτών παραδίδει στο Τ.Ε.Π.Κ.Φ. πολλαπλασιαστικό

    υλικό της υποψήφιας για εγγραφή ποικιλίας αμπέλου σε

    ημερομηνίες, ποσότητες και συσκευασίες που καθορί-
    ζονται από το Τ.Ε.Π.Κ.Φ. Το πολλαπλασιαστικό υλικό της

    υποψήφιας για εγγραφή ποικιλίας αμπέλου καλύπτει τις

    φυτοϋγειονομικές απαιτήσεις της χώρας, σύμφωνα με

    τις διατάξεις της αριθμ. 258676/29.9.2003 απόφασης και

    του π.δ. 365/2002 (Α’307), όπως έχουν τροποποιηθεί και

    ισχύουν. Εάν το πολλαπλασιαστικό υλικό της υποψήφιας

    για εγγραφή ποικιλίας αμπέλου χαθεί ή αλλοιωθεί κατά

    την μεταφορά ή την πορεία των δοκιμών ή βρεθεί ότι

    δεν πληροί τις ισχύουσες φυτοϋγειονομικές απαιτήσεις

    της χώρας και είναι ακατάλληλο, το Τ.Ε.Π.Κ.Φ. δύναται

    να ζητήσει νέες ποσότητες πολλαπλασιαστικού υλικού.
       7. Μετά το τέλος των δοκιμών, το Τ.Ε.Π.Κ.Φ. συντάσσει

    σχετική έκθεση και εισηγείται στην Τεχνική Επιτροπή

    Πολλαπλασιαστικού Υλικού (στο εξής Τ.Ε.Π.Υ.) του άρ-

    θρου 20 του ν. 1564/1985 (Α’ 164), η οποία γνωμοδοτεί
    προς τον Υπουργό Αγροτικής Ανάπτυξης και Τροφίμων

    την αποδοχή ή την απόρριψη της ποικιλίας. Η εγγραφή ή

    η απόρριψη της εγγραφής στον Εθνικό Κατάλογο γίνεται

    σύμφωνα με την παρ. 2 του άρθρου 6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι βελτιωμένες ποικιλίες αμπέλου εγγράφονται στον

    Εθνικό Κατάλογο χωρίς να υπόκεινται σε περιορισμούς
    σχετικά με τη διάρκεια της αποδοχής τους και κατά συ-
    νέπεια χωρίς να απαιτείται η ανανέωση εγγραφής τους
    σε αυτόν.

    1. Οποιαδήποτε αλλαγή στην ονομασία ή στην δια-

    τήρηση ποικιλίας αμπέλου εγγεγραμμένης στον Εθνικό

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36041

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι ποικιλίες αμπέλου διαγράφονται από τον Εθνι-

      κό Κατάλογο σύμφωνα με την παρ. 2 του άρθρου 6 του

    ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει, εάν:

    α) αποδειχθεί ότι τα στοιχεία της περ. α’ της παρ. 1 δεν

    είναι αληθή, ή

    β) αποδειχθεί ότι δεν πληρούνται οι προϋποθέσεις και

    οι υποχρεώσεις της διατήρησης σύμφωνα με το άρθρο 9

    της αριθμ. 258676/29.9.2003 απόφασης, μετά από έλεγ-

    χο του Τ.Ε.Π.Κ.Φ., ή

    γ) υποβληθεί σχετική αίτηση από τον διατηρητή της ποικιλίας.

    Στις περ. β’ και γ’, η ποικιλία δεν διαγράφεται, εάν εξα-
    σφαλισθεί η διατήρησή της.

    Άρθρο 4

    Διαδικασία εγγραφής εγχώριων
    αβελτίωτων ποικιλιών αμπέλου

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου της περ.

      γ’ του άρθρου 1, γίνονται αποδεκτές για εγγραφή στον

    Εθνικό Κατάλογο εφόσον πληρούν τις προϋποθέσεις

    της παρ. 1 του άρθρου 6 της αριθμ. 258676/29-09-2003 απόφασης.

    1. Για την καταχώριση μιας εγχώριας αβελτίωτης ποι-

      κιλίας αμπέλου στον Εθνικό Κατάλογο, δεν απαιτείται η

    διενέργεια των επίσημων ελέγχων του άρθρου 2, εφόσον

    πληρούνται οι εξής προϋποθέσεις:

    α) έχει υποβληθεί από τον διατηρητή της παρ. 3 προς

    το Τ.Ε.Π.Κ.Φ. ειδική έντυπη αίτηση που χορηγείται από

    το Τ.Ε.Π.Κ.Φ, συνοδευόμενη από:

    αα) πληροφοριακά στοιχεία σε ειδικό έντυπο που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ., τα οποία δίνουν την κατά το

    δυνατόν πληρέστερη περιγραφή της ποικιλίας, σύμφωνα

    με τα χαρακτηριστικά που αναφέρονται στο παράρτημα

    I του άρθρου 5.

    ββ) πληροφορίες που αφορούν σε ιστορικά στοιχεία

    για την περιοχή καλλιέργειας, την ονομασία και την

    καλλιέργεια της ποικιλίας (έκταση, απόδοση, ποιοτικά

    χαρακτηριστικά).

    γγ) πληροφορίες που αφορούν τις αγρονομικές συνθή-

    κες κάτω από τις οποίες έχει διαμορφωθεί και σταθερο-

    ποιηθεί η υποψήφια για εγγραφή ποικιλία αμπέλου στον

    χώρο και τον χρόνο χωρίς την επέμβαση της γενετικής επιστήμης.

    Η αίτηση καταχωρίζεται σε ειδικό μητρώο ποικιλιών

    και τηρείται φάκελος με τον αριθμό μητρώου της ποι-

    κιλίας που περιλαμβάνει την σχετική αλληλογραφία και

    όλα τα στοιχεία για την υποψήφια για εγγραφή ποικιλία.

    Η υποβολή της αίτησης γίνεται σε καθορισμένες από το Τ.Ε.Π.Κ.Φ. ημερομηνίες.

    β) Μετά την υποβολή της αίτησης και των δικαιολογη-

    τικών, το Τ.Ε.Π.Κ.Φ. συντάσσει σχετική έκθεση και ειση-

    γείται στην Τ.Ε.Π.Υ., η οποία γνωμοδοτεί για την αποδοχή

    της ποικιλίας, εφόσον τα στοιχεία της περ. α’ είναι επαρ-

    κή. Η εγγραφή των αβελτίωτων ποικιλιών αμπέλου στον

    Εθνικό Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρ-

    θρου 6 του ν. 1564/1985, όπως έχει τροποποιηθεί και

    ισχύει. Εάν μετά την υποβολή της αίτησης διαπιστωθεί
    ότι τα υποβληθέντα στοιχεία των υποπερ. ββ’ και γγ’ της

    περ. α’ δεν είναι αληθή ή δεν είναι επαρκή, το Τ.Ε.Π.Κ.Φ.

    συντάσσει σχετική έκθεση και εισηγείται στην Τ.Ε.Π.Υ.,

    η οποία γνωμοδοτεί για την απόρριψη της ποικιλίας.

    Η απόρριψη της εγγραφής της ποικιλίας στον Εθνικό

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    γ) Εάν τα υποβληθέντα στοιχεία της υποπερ. αα’ της

    περ. α’ δεν είναι επαρκή για την αποδοχή της εγχώριας

    αβελτίωτης ποικιλίας αμπέλου, το Τ.Ε.Π.Κ.Φ. γνωστοποιεί

    εγγράφως στον αιτούντα την αναγκαιότητα διενέργειας

    των επίσημων ελέγχων του άρθρου 2. Σε αυτήν την περί-

    πτωση, η διάρκεια των δοκιμών Δ.Ο.Σ. ορίζεται σε ένα (1)

    έτος, αυτές πραγματοποιούνται στις εγκαταστάσεις του

    διατηρητή ή υπό την ευθύνη του διατηρητή, ο οποίος

    παρέχει κάθε διευκόλυνση στο Τ.Ε.Π.Κ.Φ και εφαρμόζο-

    νται οι διατάξεις των παρ. 6 και 7 του άρθρου 3. Το τέλος

    που καταβάλλεται στην περίπτωση αυτή, ορίζεται στο

    50% του τέλους δοκιμής που καταβάλλεται κατά έτος ή

    καλλιεργητική περίοδο για την άμπελο, σύμφωνα με την

    αριθμ. 6321/44913/30-04-2015 απόφαση και ανεξάρ-

    τητα από τη διάρκεια των δοκιμών. Το ανωτέρω τέλος

    καταβάλλεται μία φορά.

    1. Ως διατηρητής εγχώριων αβελτίωτων ποικιλιών

      αμπέλου ορίζεται το Iνστιτούτο Ελιάς, Υποτροπικών

    Φυτών και Αμπέλου και το Iνστιτούτο Γενετικής Βελτί-

    ωσης και Φυτογενετικών Πόρων του ΕΛ.Γ.Ο.-ΔΗΜΗΤΡΑ.
    Ο διατηρητής των εν λόγω ποικιλιών αμπέλου συλλέγει

    υλικό των ποικιλιών αυτών και το εγκαθιστά στη συλλογή

    ποικιλιών αμπέλου που διατηρεί.

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου εγγρά-

    φονται στον Εθνικό Κατάλογο χωρίς να υπόκεινται σε

    περιορισμούς σχετικά με τη διάρκεια της αποδοχής τους

    και κατά συνέπεια χωρίς να απαιτείται η ανανέωση εγ-
    γραφής τους σε αυτόν.

    1. Οποιαδήποτε αλλαγή στην ονομασία ή στην δια-

    τήρηση ποικιλίας αμπέλου εγγεγραμμένης στον Εθνικό

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου δια-

      γράφονται από τον Εθνικό Κατάλογο με απόφαση

    του Υπουργού Αγροτικής Ανάπτυξης και Τροφίμων, η

    οποία δημοσιεύεται στην Εφημερίδα της Κυβερνήσεως,

    μετά από γνώμη της Τ.Ε.Π.Υ. και κατόπιν εισήγησης του Τ.Ε.Π.Κ.Φ., εάν:

    α) αποδειχθεί ότι τα στοιχεία της περ. α’ της παρ. 2 δεν

    είναι αληθή, ή

    β) αποδειχθεί ότι δεν πληρούνται οι προϋποθέσεις και

    οι υποχρεώσεις της διατήρησης σύμφωνα με το άρθρο 9

    της αριθμ. 258676/29.9.2003 απόφασης, μετά από έλεγ-

    χο του Τ.Ε.Π.Κ.Φ., ή

    γ) υποβληθεί σχετική αίτηση από τον διατηρητή της ποικιλίας.

    Στις περ. β’ και γ’, η ποικιλία δεν διαγράφεται, εάν εξα-
    σφαλισθεί η διατήρησή της.

    Άρθρο 5

    Παραρτήματα

    Προσαρτώνται στην παρούσα απόφαση τα Παραρτή-

    ματα I και II, τα οποία αποτελούν αναπόσπαστο μέρος

    της και έχουν ως εξής:

    36042                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    ΠΑΡΑΡΤΗΜΑ Ι

    (Παράρτημα Ι της Οδηγίας 2004/29/ΕΚ και εθνικές διατάξεις)

    ΜΕΡΟΣ Α

    (ΜΕΡΟΣ Α του Παραρτήματος Ι της Οδηγίας 2004/29/ΕΚ) ΜΟΡΦΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΣΧΗΜΑΤΙΣΜΟΣ ΟΦΘΑΛΜΩΝ (ΕΚΒΛΑΣΤΗΜΑ) ΕΠΙ ΑΝΑΠΤΥΣΣΟΜΕΝΗΣ ΚΛΗΜΑΤΙΔΑΣ ΜΗΚΟΥΣ 10 ΕΩΣ 20 cm

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    1.1.

    σχήμα (άνοιγμα κορυφής):

    1= κλειστή, 2= ελαφρώς ανοιχτή,

    3= μισάνοιχτη, 4= ευρέως ανοιχτή,

    5= πλήρως ανοιχτή

    2

    001

    1.2.

    χρώμα (κατά την έκπτυξη για να

    καταστεί δυνατή η παρατήρηση

    των ανθοκυανών):

    1= πράσινο, 2= άσπρο, 3= κίτρινο,

    4= χαλκόχρουν, 6= χρώμα ορειχάλκου,

    7= υπόξανθο ή ξανθοκόκκινο, 8= ρόδινο,

    9= άλλο χρώμα να περιγραφεί.

    1.3.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΠΟΩΔΗΣ ΚΛΗΜΑΤΙΔΑ ΚΑΤΑ ΤΗΝ ΕΠΟΧΗ ΤΗΣ ΑΝΘΗΣΗΣ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    2.1.

    εγκαρσία διατομή

    (σχήμα και περίγραμμα):

    2=πεπλατυσμένο, 4= ελλειπτικό,

    6= κυκλικό, 8= άλλου τύπου

    να περιγραφεί.

    2.2.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΞΥΛΩΔΗΣ ΚΛΗΜΑΤΙΔΑ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    3.1.

    επιφάνεια:

    2= κυκλική, 4= γωνιώδης, 6= οδοντωτή,

    8= αστεροειδής.

    3.2.

    μεσογονάτιο μήκος

    (8ο – 12ο):

    1= πολύ κοντό, 3= κοντό, 5= μέτριο,

    7= μακρύ, 9= πολύ μακρύ

    353

    4.ΚΑΤΑΝΟΜΗ ΤΩΝ ΕΛΙΚΩΝ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    Κατανομή ελίκων

    1= διαλείπουσα, 5= ασυνεχής,

    9= συνεχής.

    1. ΝΕΑΡΑ ΦΥΛΛΑ ΣΤΗΝ ΚΟΡΥΦΗ ΑΝΑΠΤΥΣΣΟΜΕΝΗΣ ΚΛΗΜΑΤΙΔΟΣ ΜΗΚΟΥΣ 10 ΕΩΣ 30 cm (ΤΡΙΑ ΠΡΩΤΑ

    ΦΥΛΛΑ ΣΕ ΑΠΟΣΤΑΣΗ ΑΠΟ ΤΟ ΣΧΗΜΑΤΙΣΜΟ ΟΦΘΑΛΜΩΝ (ΕΚΒΛΑΣΤΗΜΑ), ΜΕΤΡΟΥΜΕΝΑ ΑΠΟ ΑΥΤΟ ΤΟ ΣΗΜΕΙΟ)

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    5.1.

    χρώμα:

    1= κιτρινοπράσινο, 2= πράσινο,

    3= πράσινο με κηλίδες ανθοκυάνης,

    4= ανοιχτό ερυθρό χαλκόχρουν,

    5= σκούρο ερυθρό χαλκόχρουν,

    6= κρασο-κόκκινο

    6

    051

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36043

    5.2.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΠΛΗΡΩΣ ΑΝΑΠΤΥΓΜΕΝΟ ΦΥΛΛΟ (ΚΕΙΜΕΝΟ ΜΕΤΑΞΥ ΤΟΥ 8ου ΚΑΙ ΤΟΥ 11ου ΓΟΝΑΤΟΥ (ΚΟΜΒΟΥ))

    6.1.     φωτογραφία.

    6.2.     σχεδίασμα ή απ’ ευθείας εκτύπωση σε κλίμακα.

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    6.3.

    γενικό σχήμα:

    1= καρδιόσχημο, 2= σφηνοειδές,

    3= πενταγωνικό, 4= κυκλικό, 5= νεφροειδές

    18

    067

    6.4.

    αριθμός λοβών φύλλου:

    1= ένας, 2= τρεις, 3= πέντε, 4= επτά,

    5= πλέον των επτά

    20

    068

    6.5.

    μισχικός κόλπος:

    1=πολύ ανοικτός, 3= ανοικτός, 5= κλειστός,

    7= επικαλυπτόμενος, 9= πολύ επικαλυπτό-

    μενος

    618

    6.6.

    βάθος του ανώτερου και του κα-

    τώτερου πλευρικού κόλπου:

    1= αβαθές, 3= ελαφρά βαθύ, 5= μέτριο,

    7= βαθύ, 9= πολύ βαθύ.

    6.7.

    χνοασμός της κάτω επιφάνειας:

    1= απουσία, 2= μεταξώδης, 4= βελουδοειδής,

    6= αραχνοειδής, 8= χνοώδης,

    9= βαμβακώδης.

    6.8.

    επιφάνεια:

    1= επίπεδη, 2= κυματοειδής, 4= πομφολυ-

    γώδης, 6= μελικηρώδης, 8= πτυχωτή,

    9= άλλου τύπου.

    6.9.

    πλευρική οδόντωση

    (σχήμα οδόντων):

    1= δύο πλευρές κοίλες, 2= δύο πλευρές

    ευθύγραμμες, 3= δύο πλευρές κυρτές,

    4= μία πλευρά κοίλη, μία πλευρά κυρτή,

    5= συνδυασμός των δύο πλευρών ευθύ-

    γραμμων και των δύο πλευρών κυρτών

    26

    076

    1. ΑΝΘΟΣ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    εμφανές φύλο

    (αναπαραγωγικά όργανα):

    1= ανεπτυγμένοι στήμονες χωρίς γυναικεί-

    ον, 2= ανεπτυγμένοι στήμονες και υπανά-

    πτυκτο γυναικείον, 3= ανεπτυγμένοι στήμο-

    νες και αναπτυγμένο γυναικείον,

    4= γερμένοι στήμονες και αναπτυγμένο

    γυναικείον

    16

    151

    1. ΣΤΑΦΥΛΗ ΣΕ ΒΙΟΜΗΧΑΝΙΚΗ ΩΡΙΜΟΤΗΤΑ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΠΟΙΚΙΛΙΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ

    ΠΟΙΚΙΛΙΕΣ)

    8.1. φωτογραφία (με κλίμακα).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    8.2.

    σχήμα:

    1= κωνικό, 3= κωνικό προς κυλινδρικό,

    5=κυλινδρικό, 7= άλλος τύπος να περιγραφεί

    208

    8.3.

    μέγεθος

    (χωρίς τον ποδίσκο):

    1= πολύ μικρό, 3= μικρό, 5= μέτριο,

    7= μεγάλο, 9= πολύ μεγάλο

    32

    36044                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    8.4.

    ποδίσκος (μήκος):

    1= πολύ μικρό (έως 3 εκ.), 3= μικρό

    (4-5 εκ.), 5= μέτριο (6-7 εκ.), 7= μεγάλο

    (8-9 εκ.), 9= πολύ μεγάλο (μεγαλύτερο

    από 11 εκ.)

    34

    206

    8.5.

    μέσο βάρος σε γραμμά-

    ρια: λαμβάνεται το μέσο

    βάρος των μεγαλύτε-

    ρων σταφυλών από 10

    βλαστούς

    502

    8.6.

    αποράγωσις (σε 30 ρά-

    γες από το μεσαίο τμή-

    μα 10 σταφυλών, μέτρη-

    ση με δυναμόμετρο):

    1= δύσκολη, 2= μέτρια εύκολη,

    3= πολύ εύκολη.)

    38

    240

    8.7.

    πυκνότης της σταφυλής:

    1= πολύ μικρή, 3= μικρή, 5= μέτρια,

    7= μεγάλη, 9= πολύ μεγάλη

    33

    204

    1. ΡΑΓΑ ΣΕ ΒΙΟΜΗΧΑΝΙΚΗ ΩΡΙΜΟΤΗΤΑ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΠΟΙΚΙΛΙΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ

    ΠΟΙΚΙΛΙΕΣ)

    9.1. φωτογραφία (με κλίμακα).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    9.2.

    σχήμα (εξέταση 30 ρα-

    γών του μεσαίου τμήμα-

    τος 10 σταφυλών):

    1= πεπλατυσμένο, 2= σφαιρικό,

    3= μακρύ ελλειπτικό, 4= κοντό

    ελλειπτικό, 5= κυλινδρικό, 6= αμβλύ

    ωοειδές, 7= ωοειδές, 8= αντωοειδές, 9=

    τοξοειδές, 10= σχήμα δακτύλου

    36

    223

    9.3.

    πάχος με ένδειξη μέσου

    βάρους:

    1= πολύ μικρό, 3= μικρό, 5= μέτριο,

    7= μεγάλο, 9= πολύ μεγάλο

    9.4.

    χρώμα:

    1= πράσινο, 2= κίτρινο πράσινο, 3=

    κίτρινο, 4= κίτρινο ερυθρωπό, 5= ερυ-

    θρωπό, 6= ερυθρό, 7= γκρι ερυθρό, 8=

    σκούρο ερυθρό βιολετί, 9= μπλε μαύρο

    37

    225

    9.5.

    φλοιός πάχος (όσον

    αφορά τις επιτραπέζιες

    ποικιλίες):

    1= λεπτός, 2= μέτριος, 3= χονδρός

    39

    228

    9.6.

    αριθμός γιγάρτων (σχη-

    ματισμός γιγάρτων,

    όσον αφορά τις επιτρα-

    πέζιες ποικιλίες):

    1= κανένα, 2= υπανάπτυκτα, 3= πλήρη

    43

    241

    9.7.

    σάρκα (συνεκτικότητα):

    1= μαλακή ή ελαφρώς σκληρή,

    2= μετρίως σκληρή, 3= πολύ σκληρή

    41

    235

    9.8.

    χυμός:

    1= λίγο χυμώδης, 2= χυμώδης, 3= πολύ

    χυμώδης

    232

    9.9.

    άρωμα:

    1= κανένα, 2= μοσχάτο, 3= ιδιάζον

    άρωμα (foxy) που χαρακτηρίζει οίνους

    από ποικιλίες που δεν ανήκουν στο

    V. vinifera, 4= χορτώδες, 5= άλλο

    42

    236

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36045

    1. ΓΙΓΑΡΤΟ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ ΠΟΙΚΙΛΙΕΣ) φωτογραφία των δύο επιφανειών και πλάγια όψη (με κλίμακα).

    ΜΕΡΟΣ Β (εθνικές διατάξεις)

    ΠΡΟΣΘΕΤΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΜΟΡΦΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ, σύμφωνα με το πρωτόκολλο για τις Δοκιμές Διακριτότητας, Ομοιομορφίας

    και Σταθερότητας του Κοινοτικού Γραφείου Φυτικών Ποικιλιών TP/050/2 (CPVO, http://cpvo.europa.eu/sites/default/

    files/documents/vitis_2.pdf ) και με την δεύτερη έκδοση του καταλόγου δεικτών για την περιγραφή των ποικιλιών της

    αμπέλου του Διεθνούς Οργανισμού για την άμπελο και τον οίνο (OIV, http://www.oiv.int/en/technical-standards-and-

    documents/description-of-grape-varieties/oiv- descriptor-list-for-grape-varieties-and-vitis-species-2nd-edition).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    1

    Χρόνος έκπτυξης οφθαλμών (έναρξη έκπτυ-

    ξης οφθαλμών έως έκπτυξη οφθαλμών-ορα-

    τή η πράσινη κορυφή)

    1= πολύ πρώιμη, 3= πρώιμη,

    5= μέση, 7= όψιμη,

    9= πολύ όψιμη

    1

    301

    2

    Νεαρός βλαστός: έρποντα τριχίδια στην κο-

    ρυφή (ορατή ταξιανθία έως τέλος άνθησης)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια,

    7= πυκνά, 9= πολύ πυκνά

    3

    004

    3

    Νεαρός βλαστός: ένταση ανθοκυάνης των

    ερπόντων τριχιδίων στην κορυφή (όπως 2)

    1= απουσία ή πολύ ασθενής,

    3= ασθενής, 5= μέτρια,

    7= έντονη, 9= πολύ έντονη

    4

    003

    4

    Νεαρός βλαστός: όρθια τριχίδια στην κορυφή

    (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    5

    005

    5

    Νεαρό φύλλο: έρποντα τριχίδια μεταξύ των

    κύριων νεύρων στην κάτω επιφάνεια του ελά-

    σματος (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    7

    053

    6

    Νεαρό φύλλο: όρθια τριχίδια στα κύρια νεύρα

    της κάτω επιφάνειας του ελάσματος (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    8

    056

    7

    Βλαστός: στάση – πριν τη δημιουργία κόμβων

    (αρχή έως τέλος άνθησης)

    1= όρθια, 3= ημιόρθια, 5= ορι-

    ζόντια, 7=

    ημιπίπτουσα, 9=

    πίπτουσα

    9

    006

    8

    Βλαστός: χρώμα ραχιαίας πλευράς των μεσο-

    γονατίων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    10

    007

    9

    Βλαστός: χρώμα κοιλιακής πλευράς των με-

    σογονατίων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    11

    008

    10

    Βλαστός: χρώμα ραχιαίας πλευράς των κόμ-

    βων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    12

    009

    11

    Βλαστός: χρώμα κοιλιακής πλευράς των κόμ-

    βων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    13

    010

    12

    Βλαστός: όρθια τριχίδια στα μεσογονάτια

    (όπως 8)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    14

    012

    13

    Βλαστός: μήκος ελίκων (όπως 8)

    1= πολύ κοντό, 3= κοντό,

    5= μεσαίο, 7= μακρύ, 9= πολύ

    μακρύ

    15

    017

    36046                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    14

    Ώριμο φύλλο: μέγεθος ελάσματος (ράγες μέ-

    γεθος μπιζελιού έως περκασμό)

    1= πολύ μικρό, 3= μικρό,

    5= μέτριο, 7= μεγάλο, 9= πολύ

    μεγάλο

    17

    065

    15

    Ώριμο φύλλο: φλύκταινες στην πάνω επιφά-

    νεια του ελάσματος (όπως 14)

    1= απουσία ή πολύ ασθενείς,

    3= ασθενείς, 5= μέτριες,

    7= έντονες, 9= πολύ έντονες

    19

    075

    16

    Ώριμο φύλλο: βάθος των κορυφαίων πλευρι-

    κών κόλπων (όπως 14)

    1= απουσία ή πολύ μικρό, 3=

    μικρό, 5= μέτριο, 7= μεγάλο,

    9= πολύ μεγάλο

    21

    094

    17

    Ώριμο φύλλο (Μόνο ποικιλίες με έλλοβα φύλ-

    λα): θέση των λοβών των κορυφαίων πλευρι-

    κών κόλπων (όπως 14)

    1= ανοιχτοί, 2= κλειστοί,

    3= με ελαφρά επικάλυψη,

    4= με ισχυρή επικάλυψη

    22

    082

    18

    Ώριμο φύλλο: θέση των λοβών του μισχικού

    κόλπου (όπως 14)

    1= τελείως ανοιχτοί, 2= πολύ

    ανοιχτοί, 3= μισάνοιχτοι,

    4= ελαφρώς ανοιχτοί, 5= κλει-

    στοί, 6= με ελαφρά επικάλυψη,

    7= με μέση επικάλυψη, 8= με

    έντονη επικάλυψη, 9= με πολύ

    έντονη επικάλυψη

    23

    079

    19

    Ώριμο φύλλο: μήκος οδόντων (όπως 14)

    3= μικρό, 5= μέτριο,

    7= μεγάλο

    24

    20

    Ώριμο φύλλο: αναλογία μήκους/ πλάτους

    οδόντων (όπως 14)

    1= πολύ μικρή, 3= μικρή,

    5= μέση, 7= μεγάλη, 9= πολύ

    μεγάλη

    25

    078

    21

    Ώριμο φύλλο: αναλογία των κύριων νεύρων

    στην άνω επιφάνεια του ελάσματος με ανθο-

    κυάνη (όπως 14)

    1= απουσία ή πολύ μικρή,

    3= μικρή, 5= μέση, 7= μεγάλη,

    9= πολύ μεγάλη

    27

    22

    Ώριμο φύλλο: έρποντα τριχίδια μεταξύ κύρι-

    ων νεύρων στην κάτω επιφάνεια του ελάσμα-

    τος (όπως 14)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    28

    084

    23

    Ώριμο φύλλο: όρθια τριχίδια στα κύρια νεύρα

    της κάτω επιφάνειας του ελάσματος (όπως 14)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    29

    087

    24

    Ώριμο φύλλο: μήκος μίσχου σε σχέση με το

    μήκος του κεντρικού νεύρου (όπως 14)

    1= πολύ κοντύτερο, 2= ελα-

    φρώς κοντύτερο, 3= ίσο, 4=

    ελαφρώς μακρύτερο, 5= πολύ

    μακρύτερο

    30

    093

    25

    Χρόνος έναρξης ωρίμανσης της ράγας (περ-

    κασμός)

    1= πολύ πρώιμη, 3= πρώιμη,

    5= μέση, 7= όψιμη, 9= πολύ

    όψιμη

    31

    303

    26

    Ράγα: μέγεθος

    1= πολύ μικρό, 3= μικρό,

    5= μέτριο, 7= μεγάλο, 9= πολύ

    μεγάλο

    35

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36047

    27

    Ράγα: ένταση ανθοκυάνης της σάρκας (τεχνο-

    λογική ωρίμανση)

    1= απουσία ή πολύ αδύνατη,

    3= αδύνατη, 5= μέτρια,

    7= έντονη, 9= πολύ έντονη

    40

    231

    28

    Κληματίδα: κύριο χρώμα (στάδιο ληθάργου)

    1= κιτρινωπό καφέ, 2= πορτο-

    καλί καφέ, 3= σκούρο καφέ,

    4= ερυθρωπό καφέ, 5= βιολετί

    44

    103

    1. DNA ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ (DNA ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ) σύμφωνα με την δεύτερη έκδοση του καταλόγου δεικτών

    για την περιγραφή των ποικιλιών της αμπέλου του Διεθνούς Οργανισμού για   την                       άμπελο και                                                                                                                        τον

    οίνο      (OIV,     http://www.oiv.int/en/technical-standards-and- documents/description-of-grape-varieties/oiv-

    descriptor-list-for-grape-varieties-and-vitis-species-2nd- edition): δηλώνονται από τον αιτούντα στο έντυπο που

    χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων

    από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.

    α/α

    Mοριακός δείκτης

    (SSR- marker)

    Αλληλουχίες εκκινητών

    Κωδικός

    OIV

    1.

    VVS2

    [F]: CAGCCCGTAAATGTATCCATC

    [R]: AAATTCAAAATTCTAATTCAACTGG

    801

    2.

    VVMD5

    [F]: CTAGAGCTACGCCAATCCAA

    [R]: TATACCAAAAATCATATTCCTAAA

    802

    3.

    VVMD7

    [F]: AGAGTTGCGGAGAACAGGAT

    [R]: CGAACCTTCACACGCTTGAT

    803

    4.

    VVMD27

    [F]: GTACCAGATCTGAATACATCCGTAAGT

    [R]: ACGGGTATAGAGCAAACGGTGT

    804

    5.

    VrZAG62

    [F]: GGTGAAATGGGCACCGAACACACGC

    [R]: CCATGTCTCTCCTCAGCTTCTCAGC

    805

    6.

    VrZAG79

    [F]: AGATTGTGGAGGAGGGAACAAACCG

    [R]: TGCCCCCATTTTCAAACTCCCTTCC

    806

    7.

    VVMD32

    [F]: TATGATTTTTTAGGGGGGTGAGG

    [R]: GGAAAGATGGGATGACTCGC

    807

    8.

    VVMD25

    [F]: TTCCGTTAAAGCAAAAGAAAAAGG

    [R]: TTGGATTTGAAATTTATTGAGGGG

    808

    9.

    VVMD28

    [F]: AACAATTCAATGAAAAGAGAGAGAGAGA

    [R]: TCATCAATTTCGTATCTCTATTTGCTG

    809

    ΜΕΡΟΣ Γ΄ (ΜΕΡΟΣ Β του Παραρτήματος Ι της Οδηγίας 2004/29/ΕΚ) ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΒΛΑΣΤΙΚΑ ΣΤΑΔΙΑ

    1.1. Ημερομηνίες εμφανίσεως βλαστικών σταδίων

    Οι ημερομηνίες εμφανίσεως των βλαστικών σταδίων ορίζονται κατόπιν συγκρίσεως με μία ή περισσότερες από τις ακόλουθες ποικιλίες μάρτυρες.

    1.1.1. ποικιλίες λευκών σταφυλιών – Σαββατιανό (Savatiano), Ζουμιάτικο (Zoumiatiko), Βηλάνα (Vilana), Ασύρτικο

    (Assyrtiko), Chardonnay.

    1.1.2. ποικιλίες μαύρων σταφυλιών – Μανδηλαριά (Mandilaria), Ξυνόμαυρο (Xynomavro), Cabernet Sauvignon, Κορινθιακή (Korinthiaki).

    1.1.3. ποικιλίες επιτραπέζιων σταφυλιών – Ραζακί (Razaki), Cardinal, Iτάλια (Italia), Σουλτανίνα (Soultanina), Perlette.

    1.2. Ημερομηνία εκπτύξεως

    Ημερομηνία κατά την οποία εκπτύσσεται πλήρως το ήμισυ των οφθαλμών ενός πρέμνου κανονικά κλαδευμένου και φαίνεται ο εσωτερικός τους χνοασμός σε σχέση με τις ποικιλίες μάρτυρες.

    1.3. Ημερομηνία πλήρους ανθήσεως

    Ημερομηνία κατά την οποία, για ένα σύνολο φυτών, το ήμισυ των ανθέων είναι ανοικτά συγκρινόμενο με τις

    ποικιλίες μάρτυρες.

    1.4. Ωριμότης (όσον αφορά τις οινοποιήσιμες ποικιλίες και τις επιτραπέζιες ποικιλίες) Επιπροσθέτως της περιόδου

    ωριμότητος εξετάζονται η πυκνότης ή ο πιθανός βαθμός του γλεύκους, η οξύτης του και η αντίστοιχη απόδοση σε

    36048                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    σταφυλές εκφραζομένη σε χιλιόγραμμα ανά αντίστοιχο

    εκτάριο σε σύγκριση με μιά ή περισσότερες ποικιλίες

    μάρτυρες που έχουν δώσει κατά το δυνατό αποδόσεις της αυτής τάξεως μεγέθους.

    1.5. Ημερομηνία φυλλόπτωσης

    1. ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΚΑΛΛΙΕΡΓΕΙΑΣ

    2.1. Ζωηρότης: παρατήρηση κατά την άνθηση και μετά

    την φυλλόπτωση. Οπτική εκτίμηση του μήκους και της

    διαμέτρου των κύριων βλαστών. Μέση τιμή 10 βλαστών

    κοντά στον κορμό. (Κωδικός OIV 351).

    2.2. Τρόπος μορφώσεως (θέση του πρώτου καρποφό-

    ρου οφθαλμού, προτιμώμενο κλάδεμα):
       (Κωδικός OIV 155).

    2.3. Παραγωγή

    2.3.1. κανονικότης.

    2.3.2. απόδοση:

    Α) Ποικιλίες: Μετράται η απόδοση της ποικιλίας (κιλά/

    στρ.) σε σύγκριση με μια ή περισσότερες ποικιλίες μάρ-
    τυρες. (Κωδικός OIV 504).

    Β) Υποκείμενα: Μετράται η απόδοση σε μοσχεύματα ανά στρέμμα (Κωδικός OIV 551).

    2.3.3.  ανωμαλίες: Μικροραγία (Κωδικός OIV 222), αν-

    θόροια (ποσοστό καρπόδεσης, Κωδικός OIV 501), ανισο-

    ραγία (Κωδικός OIV 222).

    2.4. Ανθεκτικότης ή ευαισθησία (δηλώνεται από τον

    αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγ-

    χου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτι-

    κή προσκόμιση αποτελεσμάτων από αναγνωρισμένα

    εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.4.1. σε δυσμενείς συνθήκες: χλώρωση από έλλειψη

    σιδήρου (OIV 401), αλατότητα (OIV 402), ξηρασία (OIV

    403).

    2.4.2. σε επιβλαβείς οργανισμούς: περονόσπορος (OIV

    452-1), ωίδιο (OIV 455-1), βοτρύτις (OIV 458-1), ευτυπίω-

    ση (OIV 460), φυλλόβιος φυλλοξήρα (OIV 461), ριζόβιος φυλλοξήρα (OIV 462).

    2.4.3. πιθανή ευαισθησία στη σχάση των ραγών.

    2.5. Συμπεριφορά κατά τον αγενή πολλαπλασιασμό

    (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται

    από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυ-

    τών, με υποχρεωτική προσκόμιση αποτελεσμάτων από

    αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών

    μελών της Ε.Ε.).

    2.5.1. εμβολιασμός (OIV 552).

    2.5.2.  πολλαπλασιασμός με μοσχεύματα (OIV 553).

    1. ΧΡΗΣΙΜΟΠΟΙΗΣΗ (δηλώνεται με το έντυπο Νο 2

    από τον αιτούντα).

    3.1. για οινοποίηση.

    3.2. για επιτραπέζια χρήση.

    3.3. για υποκείμενο.

    3.4. για βιομηχανικές χρήσεις.

    ΜΕΡΟΣ Δ (εθνικές διατάξεις)

    ΠΡΟΣΘΕΤΑ ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ ΧΡΗΣΙΜΟΠΟΙΗΣΗ

    1. Για οινοποίηση (εκτίμηση της τεχνολογικής ποιό-

    τητας): Εξετάζονται συγκριτικά με μία ή περισσότερες

    ποικιλίες μάρτυρα.

    1.1. Αναλύσεις σταφυλών:

    1. i. Σακχαροπεριεκτικότητα γλεύκους (OIV 505), ii. ογκομετρούμενη οξύτητα (OIV 506),

    1.2. Αναλύσεις οίνων (μικροοινοποίηση με κοινό πρω-

    τόκολλο):

    1. i. Αλκοολικός τίτλος,

    2. ii. ογκομετρούμενη οξύτητα, iii. pH,

    3. iv. χρωματικά χαρακτηριστικά (ένταση, απόχρωση)

    (ερυθροί οίνοι),

    1. v. ολικές ανθοκυάνες (ερυθροί οίνοι),

      vi. δείκτης ολικών φαινολών (ερυθροί οίνοι),

    vii. οργανοληπτικοί χαρακτήρες (οπτική, οσφρητική

    και γευστική αξιολόγηση οίνων).

    1. Για επιτραπέζια χρήση (επιτραπέζιες ποικιλίες):

    2.1. Αναλύσεις σταφυλών:

    1. i. Σάκχαρα (OIV 505), και

    2. ii. ογκομετρούμενη οξύτητα (OIV506).

    ΠΑΡΑΡΤΗΜΑ II

    (Παράρτημα ΙΙ της οδηγίας 2004/29/ΕΚ)
    ΕΛΑΧΙΣΤΕΣ ΠΡΟΫΠΟΘΕΣΕΙΣ ΓΙΑ ΤΗΝ ΕΚΤΕΛΕΣΗ ΤΩΝ ΕΛΕΓΧΩΝ

    1. ΟΙΚΟΛΟΓΙΚEΣ ΠΛΗΡΟΦΟΡΙΕΣ (δηλώνονται στο

    έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών

    Καλλιεργουμένων Φυτών)
       1.1. τόπος

    1.2. γεωγραφικές συνθήκες

    1.2.1. γεωγραφικό μήκος

    1.2.2. γεωγραφικό πλάτος

    1.2.3. υψόμετρο

    1.2.4. έκθεση και κλίση

    1.3.      κλιματολογικές συνθήκες

    1.4. τύπος εδάφους

    1. ΤΕΧΝΙΚΕΣ ΛΕΠΤΟΜΕΡΕΙΕΣ

    2.1. Για οινοποιήσιμες ποικιλίες και επιτραπέζιες ποι-
    κιλίες

    2.1.1. 24 πρέμνα κατά το δυνατό σε διάφορα υποκεί-
    μενα

    2.1.2. τουλάχιστον 3 έτη παραγωγής

    2.1.3. τουλάχιστον 2 τόποι που έχουν διαφορετικές

    οικολογικές συνθήκες

    2.1.4. η συγκόλληση του εμβολίου πρέπει να εξετάζε-
    ται σε τουλάχιστον 3 ποικιλίες υποκειμένων

    2.2. Για ποικιλίες υποκειμένων

    2.2.1. 5 πρέμνα με τουλάχιστον 2 τρόπους αναπτύξεως

    2.2.2. 5 έτη μετά τη φύτευση

    2.2.3. 3 διαφορετικά οικολογικά περιβάλλοντα

    2.2.4. η συγκόλληση του εμβολίου πρέπει να εξετάζε-
    ται με τουλάχιστον 3 ποικιλίες εμβολίων.

    Άρθρο 6

    Καταργούμενες διατάξεις

    (άρθρο 2 της οδηγίας 2004/29/ΕΚ)

    1. Από την έναρξη ισχύος της παρούσας απόφασης

    καταργούνται:

    α) η αριθμ. 361896/02-10-1987 απόφαση των Υφυ-

    πουργών Εθνικής Οικονομίας και Γεωργίας «Τεχνικός Κα-

    νονισμός αποδοχής ποικιλιών αμπέλου (Vitis L.)» (Β’ 566).

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36049

    β) η αριθμ. 440756/30-12-1985 απόφαση του Ανα-
    πληρωτή Υπουργού Γεωργίας «Γενικός Τεχνικός Κα-

    νονισμός Αποδοχής Ποικιλιών των καλλιεργουμένων

    φυτικών ειδών» (Β’ 124/26-03-1986), όπως συμπλη-

    ρώθηκε με την αριθμ. 454372/30-01-1987 υπουργική

    απόφαση «Συμπλήρωση των διατάξεων του Γενικού

    Τεχνικού Κανονισμού Αποδοχής Ποικιλιών των καλλι-

    εργουμένων φυτικών ειδών» (Β’ 111) και τροποποιήθηκε

    με τις αριθμ. 320696/24-07-1987 «Τροποποίηση της με

    αριθμ. 440756/30-12-1985 απόφασης «Γενικός Τεχνικός

    Κανονισμός Αποδοχής Ποικιλιών των καλλιεργουμένων

    φυτικών ειδών» (ΦΕΚ 124/τ.Β’/26.03.1986) όπως συμπλη-

    ρώθηκε μεταγενέστερα» (Β’ 445) και 414558/22-12-2000

    «Τροποποίηση της αριθμ. 440756/30-12-1985 Υπουρ-

    γικής Απόφασης «Γενικός Τεχνικός Κανονισμός Αποδο-

    χής Ποικιλιών των καλλιεργουμένων φυτικών ειδών»

    (Β’ 124)» (Β’ 1627), ως προς το μέρος που αφορά τις ποι-
    κιλίες αμπέλου.

    1. Κάθε αναφορά στις ως άνω καταργούμενες αποφά-

    σεις θεωρείται ως παραπομπή στην παρούσα απόφαση.

    Άρθρο 7

    Έναρξη ισχύος

    Η απόφαση αυτή αρχίζει να ισχύει από τη δημοσίευσή

    της στην Εφημερίδα της Κυβερνήσεως.

    Η απόφαση αυτή να δημοσιευθεί στην Εφημερίδα της

    Κυβερνήσεως.

    Αθήνα, 22 Ιουνίου 2018

    Ο Υφυπουργός

    ΒΑΣΙΛΕΙΟΣ ΚΟΚΚΑΛΗΣ

    36050                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    Advertisements
     

    Απάντηση

    This site uses Akismet to reduce spam. Learn how your comment data is processed.

c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Απάντηση
e
Αλλαγή
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Ακύρωση
Αρέσει σε %d bloggers: