Updates from Ιουλίου, 2018 Toggle Comment Threads | Συντομεύσεις πληκτρολογίου

  • lithari 11:55 pm on 31/07/2018 Μόνιμος σύνδεσμος |  

    HeyPhones…η ραδιοεπικοινωνία hacker/ham… Με κομμένη την ανάσα παρακολούθησε η διεθνής κοινότητα την επιχείρηση απεγκλωβισμού των 12 παιδιών και του προπονητή τους στο ποδόσφαιρο, από το πλημμυρισμένο συγκρότημα σπηλαίων Ταμ Λουάνγκ στην Ταϊλάνδη…  

    Τα μέσα που χρησιμοποιήθηκαν για τη διάσωση στην Ταϊλάνδη (Φωτό)

    Με κομμένη την ανάσα παρακολούθησε η διεθνής κοινότητα την επιχείρηση απεγκλωβισμού των 12 παιδιών και του προπονητή τους στο ποδόσφαιρο, από το πλημμυρισμένο συγκρότημα σπηλαίων Ταμ Λουάνγκ στην Ταϊλάνδη. 

    Η πλευρά των επιχειρήσεων διάσωσης που δεν έγινε γνωστή έχει να κάνει με την τεχνολογία που χρησιμοποιήθηκε και είναι η ραδιοεπικοινωνία hacker/ham. Βοήθεια ζητήθηκε από το Βρετανικό Συμβούλιο Διασώσεων Σπηλιών (BCRC) και η ανταπόκριση ήρθε από τους βρεττανούς διασώστες, οι οποίοι χρησιμοποίησαν τις συσκευές επικοινωνίας που ονομάζονται HeyPhones.

    Πρόκειται για συσκευές σχεδιάστηκαν πριν από 17 χρόνια από τον John Hey, ο οποίος πλέον δεν βρίσκεται εν ζωή και έχουν χρησιμοποιηθεί σε πολλές επιχειρήσεις όλα αυτά τα χρόνια σε όλο τον κόσμο. Το HeyPhone πλέον θεωρείται ξεπερασμένο, όμως χρησιμοποιείται ακόμη από πολλές ομάδες.

    Το ραδιοσύστημα χρησιμοποιεί USB (upper sideband και όχι το γνωστό universal serial bus) στα 87 kHz. Η χαμηλή συχνότητα αυτή μπορεί να διεισδύσει βαθιά στο έδαφος χρησιμοποιώντας κεραίες επαγωγικού βρόγχου (όπως το παλαιότερο Molephone) ή πιο συχνά, ηλεκτρόδια που εισάγουν ενέργεια RF κατευθείαν στο έδαφος. Το σύστημα είναι αρκετά παλιό, αλλά προφανώς λειτουργεί αρκετά καλά και γι’ αυτό και χρησιμοποιείται ακόμη.

    Τα κινητά τηλέφωνα και η επίγεια επικοινωνία που είναι σχετικά δεδομένη πλέον, δεν λειτουργεί υπόγεια ή σε περίπτωση μαζικής καταστροφής και αυτό είναι κάτι που συνήθως ξεχνάμε. Οι χειριστές ραδιοφώνου έχουν εξαιρετικά σημαντικό ρόλο στην κατασκευή και την εγκατάσταση εξειδικευμένων ραδιοσυστημάτων σε καταστροφικά περιστατικά ή σε αυτή την περίπτωση, όπου οι άνθρωποι χρειάζονται διάσωση από ένα ειδικό περιβάλλον.

    Advertisements
     
  • lithari 12:03 am on 31/07/2018 Μόνιμος σύνδεσμος |  

    Μια απότομη αύξηση της εδαφικής υγρασίας μπορεί να μοιράσει τον καρπό στην μέση ΤΟΥ ΣΥΚΟΥ.Η καλλιέργεια της συκιάς Συκιά: Δέντρο και καρπός Η συκιά είναι ένα δέντρο από τις απαρχές του χρόνου. Εφύετο στον Κήπο της Εδέμ και με τα φύλλα της κάλυψαν τη γύμνια τους οι πρωτόπλαστοι. Στην ελληνική μυθολογία ο τιτάνας Συκέας έδωσε το όνομα του στο δέντρο αυτό. Η επιστήμη της γεωλογίας μας πληροφορεί για απολιθώματα που φτάνουν ως την Κρητιδική Περίοδο (περίπου 70 ως 130 εκ. χρόνια πριν από σήμερα). Πλήθος άλλων ευρημάτων μας πληροφορεί για την ύπαρξη της συκιάς και της χρήσης του καρπού της. Στην Αρχαία Ελλάδα φύονταν συκιές σε όλες τις πόλεις και η κατανάλωση τόσο των νωπών όσο και των αποξηραμένων σύκων ήταν πολύ διαδομένη. Υπάρχουν πολλές αναφορές από αρχαίους συγγραφείς στα συγγράμματα τους… 

    Η καλλιέργεια της συκιάς

    Η συκιά είναι γνωστή από αρχαιοτάτων χρόνων, αφού γίνονται αναφορές για την καλλιέργεια της στις Νότιες Αραβικές χώρες από το 2900 π.Χ.. Από εκεί διαδόθηκε μέσω των διαφόρων εξερευνητών και στον υπόλοιπο κόσμο.

    Κλιματικές απαιτήσεις

    Είναι φυτό των υποτροπικών περιοχών με καλή προσαρμοστικότητα και σε πιο κρύα κλίματα. Όμως τα νεαρά δενδρύλια είναι ιδιαίτερα ευπαθή στους παγετούς και χρειάζονται προστασία, ιδιαίτερα από τους παγετούς της Άνοιξης. Οι συκιές δεν απαιτούν ώρες χαμηλών θερμοκρασιών για να σπάσουν τον λήθαργο. Προτιμά τα καλά στραγγισμένα, εύφορα εδάφη.

    Αποστάσεις φύτευσης

    Επειδή οι συκιές είναι ιδιαίτερα μεγάλα δέντρα από την φύση τους, παλαιότερα η φύτευση τους γινόταν ανάλογα με την ποικιλία, σε αποστάσεις 9-12 m μεταξύ των δέντρων. Σήμερα η φύτευση γίνεται σε πιο κοντινές αποστάσεις 4-5 m δεντρό από δεντρό και 6-7 m μεταξύ των γραμμών.

    Κλάδεμα Καρποφορίας

    Όλες οι εμπορικές ποικιλίες είναι δίφορες. Η πρώτη παραγωγή σχηματίζεται πάνω σε κλαδιά από ξύλο της προηγούμενης χρονιάς, ενώ η κύρια παραγωγή είναι αργότερα, όταν αναπτυχθούν στο νέο ξύλο τα φύλλα και ανθοφορήσει. Οι καρποί της κύριας παραγωγής σχηματίζονται στις μασχάλες των φύλλων του νέου ξύλου. Για αυτό το λόγο δεν χρειάζεται να επιλέξουμε στο κλάδεμα τα κλαδιά πάνω στα οποία θα καρποφορήσουν όπως κάνουμε και με τις υπόλοιπες καρποφόρες καλλιέργειες. Ένα ελαφρύ χειμερινό κλάδεμα θα βοηθήσει την ανάπτυξη του νέου ξύλου και θα αυξήσει την κύρια παραγωγή. Κλαδιά τα οποία είναι αρρωστημένα, σπασμένα πρέπει να αφαιρούνται. Το κλάδεμα όταν συνδυάζεται με καλή διαχείριση των δέντρων, θα έχει σαν αποτέλεσμα την ανάπτυξη 4-6 σύκων ανά βλαστό. Η υπερβολική βλαστική ανάπτυξη θα έχει σαν αποτέλεσμα την μείωση της ποιότητας των σύκων. Λίγα κλαδιά της προηγούμενης χρονιάς πρέπει να αφήνονται κατά το κλάδεμα, γιατί πάνω σε αυτά θα καρποφορήσουν οι δίφοροι καρποί της επόμενης χρονιάς, οι οποίοι μπορεί να κλαδευτούν αργότερα στην χρονιά.

    Δέντρα μεγαλύτερα σε ηλικία απαιτούν ένα πιο αυστηρό κλάδεμα κάθε 3 χρόνια, για να ενθαρρυνθεί έτσι η ανάπτυξη νέου ξύλου στο οποίο θα καρποφορήσει η κύρια παραγωγή. Τα δέντρα πρέπει να έχουν υγιές ριζικό σύστημα για να ξεπεράσουν στο βαρύ κλάδεμα. Αν υπάρχει βαριά προσβολή από νηματώδης στο έδαφος, μπορεί να οδηγήσει και σε απώλεια ορισμένων δέντρων.

    Κλάδεμα διαμόρφωσης 

    Συνήθως διαμορφώνουμε τα δέντρα σε σχήμα ανοιχτού κυπέλου, αυτό επιτρέπει την εύκολη πρόσβαση για την συλλογή των καρπών. Στην Ιαπωνία χρησιμοποιείται μια μέθοδος κλαδέματος spur. Τα νεαρά φυτά δένονται κάτω, έτσι ώστε να αναπτύσσονται σχεδόν οριζόντια. Κάθε χρόνο αφήνονται βλαστοί να αναπτυχθούν πάνω σε αυτά τα κλαδιά. Στο τέλος κάθε χρονιάς οι βλαστοί κόβονται κοντά στη βάση, με παρόμοιο τρόπο που κλαδεύονται τα σταφύλια.

    Άρδευση

    Οι συκιές μπορούν να αντέξουν σε συνθήκες με χαμηλή ξηρασία, παρόλα αυτά απαιτείται άρδευση. Η συχνότητα αυτής εξαρτάται από το μέγεθος του δέντρου, την ζωτικότητα του, τον τύπο του εδάφους και την βροχόπτωση. Οι μεγάλες διακυμάνσεις στην εδαφική υγρασία καλό είναι να αποφεύγονται γιατί οι περισσότερες ποικιλίες δεν ανταποκρίνονται καλά κάτω από αυτές τις συνθήκες. Τα συνήθη φαινόμενα είναι η πτώση των φύλλων και των καρπών όταν τα δέντρα βρίσκονται κάτω από συνθήκες στρες. Τα δέντρα υποφέρουν εύκολα από στρες, ιδιαίτερα στις ξηρές περιόδους επειδή έχουν επιπόλαιο ριζικό σύστημα. Σε μερικές ποικιλίες αν η άρδευση δεν είναι αρκετή μπορεί να υπάρξει καρπόπτωση όταν η άνοιξη είναι ξηρή. Η συκιά απαιτεί σταθερή άρδευση κατά την διάρκεια ανάπτυξης των καρπών. Λίγο νερό έχει το αποτέλεσμα την δημιουργία άδειων καρπών ή καρπών με λίγη σάρκα. Μια απότομη αύξηση στην εδαφική υγρασία κατά την διάρκεια της ωρίμανσης των καρπών έχει σαν αποτέλεσμα ο καρπός να μοιραστεί στην μέση. Υπερβολική άρδευση στο μέσο του καλοκαιριού έχει σαν αποτέλεσμα την ανάπτυξη της βλάστησης εις βάρος της ποιότητας των καρπών. Τα σμυρναίικα έχουν τα περισσότερα προβλήματα σχετικά με την ποιότητα των καρπών όταν υπάρχει αυξημένη βλάστηση.

    Εικόνα 1: Μια απότομη αύξηση της εδαφικής υγρασίας μπορεί να μοιράσει τον καρπό στην μέση

    Διαχείριση του εδάφους

    Η βαθιά καλλιέργεια του εδάφους πρέπει να αποφεύγεται για αποφευχθεί η ζημιά στο ρηχό ριζικό σύστημα της συκιάς. Συστήνεται η χρησιμοποίηση εδαφοκαλυπτικών μεταξύ των γραμμών για να αποφευχθεί η διάβρωση του εδάφους ή χρησιμοποίηση γρασιδιών ή ψυχανθών τα οποία πρέπει να κουρεύονται πριν αυτά να ανθίσουν.

    Λίπανση

    Ο έλεγχος της βλάστησης είναι αναγκαίος για την καλή ποιότητα των καρπών, αλλά αυτό δεν σημαίνει ότι τα δέντρα δεν χρειάζονται λίπασμα. Πρέπει να παρέχονται ικανοποιητικές ποσότητες έτσι ώστε το φύλλωμα να παραμένει υγιές, γιατί προστατεύει τον καρπό από ηλιόκαμα κατά το καλοκαίρι.

    Πρέπει να εφαρμόζονται μικρές εφαρμογές υδατοδιαλυτών λιπασμάτων μέσω του συστήματος άρδευσης ανά δεκαπενθήμερο καθ’ όλη την διάρκεια της περιόδου. Συνήθως χρησιμοποιούνται λιπάσματα του τύπου 20-5-20. Πρέπει να γίνεται φυλλοδιαγνωστική μετά την συγκομιδή και προσαρμόζουμε την λίπανση ανάλογα. Κομπόστα ή κοπριά μπορεί να εφαρμοστεί κατά τον χειμώνα. Οι συκιές γενικά προτιμούν τα αλκαλικά εδάφη με το ιδανικό pH= 6-7.8.

    Καρπόπτωση

    Η καρπόπτωση μπορεί να οφείλεται σε πολλούς παράγοντες όπως ο κρύος καιρός, ανεπαρκής άρδευση, αδύνατα δέντρα και νηματώδης.  Τα σύκα τα οποία αναπτύσσονται στην άκρη των κλαδιών συνήθως ξηραίνονται και πέφτουν επειδή δεν υπήρχε αρκετή ζέστη για να ωριμάσουν. Τα σμυρναίικα σύκα πέφτουν όταν δεν έχει γίνει η γονιμοποίηση.

    Εχθροί και Ασθένειες

    Στους κυριότερους εχθρούς συμπεριλαμβάνονται οι νηματώδης του γένους Meloidogyne καθώς και έντομα όπως ο κηροπλάστης, η μύγα των σύκων ή Λογχαία, αλλά και η μεσογειακή μύγα.

    Οι μόνες ασθένειες που προσβάλουν την συκιά είναι η ανθράκωση και η σκωρίαση οι οποίες αντιμετωπίζονται με την χρήση χαλκού ή άλλων κατάλληλων μυκητοκτόνων.

    Εικόνα 2: Προσβολή από σκωρίαση σε φύλλα συκιάς

    Πηγή: http://polylitoikairoi.blogspot.com/2011/07/ficus-carica.html

    Αυτό που νομίζουμε ως καρπό της συκιάς δεν είναι στην πραγματικότητα καρπός, αλλά ένας ολόκληρος κλειστός, εσωτερικός κήπος – όπως έχει πει και ο Dawkins. Αυτό που αντικρίζουμε ανοίγοντας το σύκο, είναι ένα παρτέρι, μια ανθοφορία μικροσκοπικών λουλουδιών, που καρπός τους είναι τα «σποράκια» που νοιώθουμε να σπάνε στα δόντια μας, όταν το δαγκώσουμε.

    ο κυκλος του ψηνα

    Η επικονίαση της συκιάς γίνεται από ένα υμενόπτερο έντομο, το «βλαστοφάγο ψήνα» (Blastophaga psenes), που διαχειμάζει μέσα στην ταξιανθία της άγριας συκιάς με τη μορφή προνύμφης. Όταν συμπληρώσει το βιολογικό κύκλο του ο βλαστοφάγος, βγαίνει από τον «αφαλό» της ταξιανθίας και ψάχνει θηλυκά άνθη για να τοποθετήσει τα αβγά του. Βγαίνοντας από τον αφαλό, η γύρη των αρσενικών ανθών κάθεται στο σώμα του και έτσι μεταφέρεται στα θηλυκά άνθη της ήμερης συκιάς.

    http://www.bioprasino.gr

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Τοπικά Προϊόντα της Εύβοιας

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    «Το δέντρο της Συκιάς», Ηρακλής Κ.

    Συκιά: Δέντρο και καρπός

    Βότανα και Αρωματικά Φυτά

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    http://blogs.sch.gr/aeiforia/

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Συκιά: Δέντρο και καρπός

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Η συκιά είναι ένα δέντρο από τις απαρχές του χρόνου.

    Εφύετο στον Κήπο της Εδέμ και με τα φύλλα της κάλυψαν τη γύμνια τους

    οι πρωτόπλαστοι. Στην ελληνική μυθολογία ο τιτάνας Συκέας έδωσε το

    όνομα του στο δέντρο αυτό.

    Η επιστήμη της γεωλογίας μας πληροφορεί για απολιθώματα που φτάνουν

    ως την Κρητιδική Περίοδο (περίπου 70 ως 130 εκ. χρόνια πριν από

    σήμερα). Πλήθος άλλων ευρημάτων μας πληροφορεί για την ύπαρξη της

    συκιάς και της χρήσης του καρπού της.

    Στην Αρχαία Ελλάδα φύονταν συκιές σε όλες τις πόλεις και η κατανάλωση

    τόσο των νωπών όσο και των αποξηραμένων σύκων ήταν πολύ διαδομένη.

    Υπάρχουν πολλές αναφορές από αρχαίους συγγραφείς στα συγγράμματα

    τους και τα αρχαιολογικά ευρήματα σε Λέσβο, Κρήτη και αλλού δίνουν

    πλήθος πληροφοριών.

    Στην σημερινή Ελλάδα καλλιεργείται κυρίως στους νομούς Μεσσηνίας,

    Αρκαδίας,      Λακωνίας       και      Εύβοιας.      Έτσι      εμείς      αποφασίσαμε      να

    ασχοληθούμε με το τοπικό αυτό προϊόν. Θα γνωρίσουμε το δέντρο και τον

    καρπό μέσα από διάφορους τομείς με κύριο βάρος στην καλλιέργεια και

    αποξήρανση των σύκων στον τόπο μας.

    Μπορείτε να κάνετε κλικ σε κάθε μια ενότητα και να διαβάσετε τα σχετικά

    άρθρα του ιστολογίου μας.

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Μυθολογία

    Προϊστορία

    Ιστορία

    Θρησκεία

    Η Συκιά, καλλιέργεια και παραγωγή αποξηραμένων σύκων στην

    Εύβοια

    Συσκευασία Σύκων σε εταιρεία στο Βασιλικό Εύβοιας

    Σπιτικά λιαστά σύκα

    Δημοσκόπηση: Τα σύκα σπίτι μας

    Διατροφή

    Παιχνίδι – Μεσοστοιχίδα – Διαδραστικό Παιχνίδι

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Η συκιά, καλλιέργεια και παραγωγή αποξηραμένων σύκων στην

    Εύβοια

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    ΣΥΚΙΑ

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    πώς λέγεται και τι δέντρο είναι;

    Η συκιά (Ficus carica domestica) είναι

    ένα ανθεκτικό δέντρο της οικογένειας

    Moraceae. Είναι φυλλοβόλο με μέτριο

    ως μεγάλο ύψος. Είναι δύοικο φυτό,

    δηλαδή τα άνθη, άρρεν και θήλυ,

    βρίσκονται σε διαφορετικά φυτά

    (οικίες).

    Πού βρίσκεται γεωγραφικά;

    Ευδοκιμεί σε θερμά κλίματα και

    καλλιεργείται σ’ όλη την Μεσόγειο. Στην Ελλάδα υπάρχουν

    συστηματικές καλλιέργειες: στην Εύβοια – Ταξιάρχη (σμυρνέικη

    ποικιλία) και Κύμη(ποικιλία Τραγανά Ευβοίας)και στην Πελοπόννησο –

    Μεσσηνία, Αρκαδία και Λακωνία.

    Πόσο ζει και καρπίζει;

    Η συκιά ζει 50-60 χρόνια και αποδίδει καλή

    παραγωγή για 40-50 χρόνια.

    Πότε και πώς τη φυτεύουμε;

    Η καλύτερη εποχή είναι το φθινόπωρο και πολλαπλασιάζεται με διάφορους

    τρόπους:

    1. Μοσχεύματα:Κομμάτιαβλαστών με δύο τουλάχιστον μεταγονάτια

    διαστήματα που όταν βρεθούν σε κατάλληλες συνθήκες

    θερμοκρασίας, υγρασίας και αερισμού σχηματίζουν ρίζες ή/και

    βλαστούς. Υποβοηθούνται από τις ορμόνες ριζοβολίας.

    1. Σπόροι:Είναι σπανιότερη μέθοδος και χρησιμοποιείται όταν

    θέλουμε να δημιουργήσουμε νέες ποικιλίες.

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Τι περιποίηση χρειάζεται;

    Χώμα: Ευδοκιμεί σε όλους σχεδόν τους τύπους εδάφους. Πρόβλημα έχει

    στα υγρά, βαριά χώματα. Έχει την δυνατότητα να απλώνει τις ρίζες της σε

    μεγάλες αποστάσεις και έτσι μπορεί να εξασφαλίζει τα θρεπτικά στοιχεία

    που χρειάζεται.

    Νερό: Η συκιά θέλει ελαφρύ ομοιόμορφο πότισμα.

    Το πολύ νερό καταστρέφει τα σύκα: ή σκάνε ή

    έχουν πολύ υγρασία και δεν αποξηραίνονται

    εύκολα, με συνέπεια την υποβάθμιση του

    προϊόντος.

    Κλάδεμα: Δεν χρειάζεται ιδιαίτερο κλάδεμα.

    Γίνεται «κλαδοκάθαρος» για να διατηρήσουμε το

    σχήμα της συκιάς και να βοηθήσουμε τον ήλιο και τον αέρα να μπουν στο

    εσωτερικό του δέντρου.

    Λίπανση: Γίνεται με χωνεμένη κοπριά, χρειάζεται αρκετό άζωτο και

    επάρκεια σε ασβέστιο, κάλιο και σίδηρο.

    Πώς γονιμοποιείται η συκιά;

    Το άνθος είναι αρσενικό ή θηλυκό. Τα μικρά σύκα

    (θηλυκά) γονιμοποιούνται όταν από την μικρή τρύπα

    που υπάρχει στην κορυφή τους μπει ένα μικρό έντομο,

    ο ψήνας, ο οποίος μεταφέρει γύρη από ένα αγριόσυκο

    (ερινεός) που έχει αρσενικά άνθη. Τα μικρά όμως

    σύκα (θηλυκά) μπορεί να αναπτυχθούν πολλές φορές

    και χωρίς γονιμοποίηση (παρθενοκαρπία).

    Εχθροί του δέντρου: η ψύλλα, η ψώρα της συκιάς (κηροπλάστης), η μαύρη

    μύγα των σύκων, η λογχαία των σύκων.

    Συγκομιδή: Γίνεται συνήθως τέλος Αυγούστου – αρχές Σεπτεμβρίου.

    Αποξηραμένα σύκα: ποια είναι η παραγωγή στην Ελλάδα;

    Περίπου: 4000-5000 τόνοι στην Πελοπόννησο

    2500

    150

    τόνοι στην Εύβοια κυρίως Ταξιάρχη (ολόκληρα)

    τόνοι στην Κύμη (σχιστά)

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Ποιοι είναι οι τρόποι επεξεργασίας στην Εύβοια;

    Στην Εύβοια υπάρχουν 2 περιοχές που παράγουν ξερά σύκα: της Κύμης και

    της Ιστιαίας (Ταξιάρχης, Ωρεοί, Ν. Πύργος, Καστανιώτισσα). Αναλυτικά:

    Κύμη

    Η παραγωγή είναι μικρή, όμως ποιοτικά θεωρούνται τα καλύτερα σύκα

    παγκοσμίως.

    Συλλογή και αποξήρανση

    Υπάρχουν 2 τύποι αποξηραμένων σύκων: τα φυσικά και τα λευκασμένα.

    Αρχικά τα ώριμα σύκα που έχουν μαζευτεί απ’

    ευθείας από το δέντρο με το χέρι, στην κατάλληλη

    στιγμή ωρίμανσης, ανοίγονται στα δύο (χωρίς να

    χωριστούν τα κομμάτια), ώστε να φύγει η υγρασία.

    Παραμένουν στον ήλιο για 2-3 μέρες. Στην συνέχεια

    συγκολλούνται ανά δύο.

    Στα φυσικά δεν έχουμε άλλη επεξεργασία από τον

    παραγωγό. Δεν κλιβανίζονται και δεν θειαφίζονται.

    Τα λευκασμένα υφίστανται θείωση. Τα σύκα στρώνονται σε τελάρα,

    τοποθετούνται σε κλίβανο και προστίθεται το θειάφι. Με την καύση του

    θειαφιού απελευθερώνεται διοξείδιο του θείου. Με αυτόν τον τρόπο γίνεται

    καταπολέμηση των μυκήτων και εντόμων, είναι επίσης, το SO2, ένα πολύ

    καλό συντηρητικό. Τα θειαφισμένα σύκα παραμένουν στον ήλιο για 5-6

    ώρες. Με την ηλιακή ακτινοβολία γίνεται η λεύκανση του σύκου. Εξ αιτίας

    του θειαφιού, το λευκασμένο σύκο έχει ελαφρώς υπόξινη γεύση.

    https://drive.google.com/open?id=1kYVpN3N90ETbuGha9mafUABDDHiIzTGC

    Thank you for using PDFelement 6 Professional.

    You can only convert up to 5 pages in the trial version.

    To get the full version, please purchase the program here:

    http://cbs.wondershare.com/go.php?pid=2990&m=db

     
  • lithari 7:47 pm on 28/07/2018 Μόνιμος σύνδεσμος |  

    Διαβάστε την απαντήσει του Δ.Σ. της αδελφότητος Βασιλοπουλιώτων Ηπείρου με ημερομηνία 20-07-2018 και με Αριθμ. Πρωτ. 10 . ακολουθούν ((Είκοσι δυο (22) ερωτήματα για προβληματισμό προς το Δ.Σ. της εν Αθήνας αδελφότητος Βασιλοπουλίτων Ηπείρου. )) 

    Διαβάστε την απαντήσει του Δ.Σ. της αδελφότητος  Βασιλοπουλιωτων  Ηπείρου με ημερομηνία 20-07-2018 και Αριθμ. Πρωτ. 10 .

    Δεν θα επανέλθω στα συμπεράσματα των απαντήσεων που  μου απέστειλε το Δ.Σ. ενδεχόμενος να επανέλθω στην πάροδο του χρόνου και οπότε το θεωρήσω  σκόπιμο.

    Η οποίες σκέψης κρίσης και απόψεις ας καταλήξει ο κάθε συγχωριανός που διάβασε  τα ερωτήματα και της απαντήσεις .apantisi se ervtimata sto d.s adel basi 20-07- 2018 arth prot 10 (1)apantisi se ervtimata sto d.s adel basi 20-07- 2018 arth prot 10 (2)fakelos ds adelf basil

     ΕΠΙΣΥΝΑΠΤΕΤΕ Η ΗΛΕΚΤΡΟΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΠΟΥ ΕΙΧΑΝ ΑΝΑΡΤΗΘΕΙ  Η ΕΡΩΤΗΣΗΣ   ΚΑΘΩΣ ΑΝΤΙΣΤΟΙΧΑ Η ΑΠΑΤΗΣΕΙΣ ΤΟΥ Δ.Σ ΤΗΣ ΑΔΕΛΦΟΤΗΤΟΣ. https://boskotsopanhs.wordpress.com/2018/05/06/%ce%b5%ce%af%ce%ba%ce%bf%cf%83%ce%b9-%ce%b4%cf%85%ce%bf-22-%ce%b5%cf%81%cf%89%cf%84%ce%ae%ce%bc%ce%b1%cf%84%ce%b1-%ce%b3%ce%b9%ce%b1-%cf%80%cf%81%ce%bf%ce%b2%ce%bb%ce%b7%ce%bc%ce%b1%cf%84%ce%b9/

    ΤΟΥΣ ΕΥΧΑΡΙΣΤΩ ΓΙΑ ΤΙΣ  ΑΠΑΝΤΗΣΗΣ ΠΑΡΑ ΤΟ ΓΕΓΟΝΟΣ ΟΤΙ ΕΙΝΑΙ ΕΛΛΙΠΕΙΣ.

    Επαναλαμβάνω τα όποια  συμπεράσματα ας καταλήξουν οι  φίλοι  που διαβάζουν το κείμενο .

    ========================================================

    lithari 5:42 pm on 06/05/2018 Απάντηση | Αλλαγή | Follow  

    Είκοσι δυο (22) ερωτήματα για προβληματισμό προς το Δ.Σ. της εν Αθήνας αδελφότητος Βασιλοπουλίτων Ηπείρου.

    Επιτρέψτε μου μια Απλή  διαπίστωση, όποιος λαός ξεχνά την ιστορία – θρησκεία του χάνετε από προσώπου γης .

    Θέλω να  πιστεύω ότι το παρακάτω κείμενο  θα προβληματίσει και η ερωτήσεις που παρατίθενται  τύχουν της άμεσης απάντησης. Ίσως προσθέσουν ένα μικρό λιθαράκι στης ενέργειες – πράξη – έργα  του νεοεκλεγμένου Δ.Σ. της αδελφότητος μας  .                                                                          

                                                                    ΑΙΤΗΣΗ

    Προς το  Δ.Σ. της  αδελφότητος  των εν Αθήνας  Βασιλοπουλιτών  ΔΙΑ ΜΕΣΟΥ ΤΟΥ ΠΡΟΕΔΡΕΙΟΥ ΤΗΣ ΓΕΝΙΚΗΣ ΣΥΝΕΛΕΥΣΗΣ  ΤΗ 6 TOY ΜΑΡΤΗ  2018

    Αξιότιμα  μέλη του Δ.Σ. της αδελφότητος μας, Παρακαλώ όπως με ενημερώσετε στις παρακάτω απορίες και ερώτησης,

    .ρωτώ:

    1. Συμμετείχαν οι αντιπρόσωποι της αδελφότητας μας στην Πανηπειρωτική Συνομοσπονδία Ελλάδος  στην συνεδρίασης της   σχετικά με την ψηφοφορία  για ψήφισμα εναντία  στον  ερευνών  για εξόρυξη πετρέλαιο στην περιοχή, του κατά παράδοση δήμου Ζίτσας  και πια ήταν η ψήφο τους. 

    Ήταν  απόφαση του Δ.Σ. η ενέργησαν αυτόβουλα και σύμφωνα με την δική τους προσωπική άποψης.

    1. Ενημερώθηκε μέσου επισήμου Έγγραφου το απερχόμενου Δ.Σ. της αδελφότητος  από τον πρόεδρο  του χωριού μας   σχετικά με το θέμα της εξόρυξης  πετρελαίου  στην περιοχή του δήμου Ζίτσας και αν ναι ποιες η ενέργειες πραγματοποίησε  το απερχόμενου Δ.Σ. άλλα και ποιες απόφασης  πρέπει να παρθούν  από την σημερινή  Γ.Σ. ώστε το επόμενο Δ.Σ. να έχει μια βάση που να εκφράζει της απόψεις της  Γ.Σ.***

    2. Έχει πάρει σχετική απόφαση το απερχόμενου Δ.Σ. της αδελφότητος σχετικά με τη εξόρυξη η όχι πετρελαίου στη περιοχή του χωρίου μας και τη ακριβός αναφέρει.

    3. Ενημερώθηκε επίσημα και έγγραφος η προφορικός το απερχόμενου Δ.Σ. της αδελφότητος, για την απόφαση του ΠΡΟΕΔΡΟΥ για το αίτημα του  στο Δ.Σ.  του δήμου Ζίτσα για την κοπή του δάσους στα όρια  της δημοτικής ενότητας Βασιλοπούλου ( σχετικό έγγραφο αν υπάρχει ) .

    4. Συμμετείχε επίσημα το απερχόμενου Δ.Σ. της αδελφότητος στης άτυπη  ετήσια συνέλευση του χωρίου μας οπού αποφασίστηκε η κοπή των δασών στα όρια  της δημοτικής ενότητας Βασιλοπούλου ( ιστορικά, άλλα και να μαθαίνουν η νεότεροι) 2000  τουρκικές Χρύσες λίρες , περίπου 13  δεκατρία κιλά χρυσό πλήρωσαν η  ΠΡΟΠΑΠΠΟΥΔΕΣ  ΜΑΣ    για την εξαγορά των πουρναριών και της γης της Μπριάνιστα ώστε να αισθανόταν  περήφανοι  Έλληνες  .

    5. Το γεγονός ότι αναρτήθηκαν η δασική χάρτες με αποκλειστικές ημερομηνίες  για την υποβολή ενστάσεων, ως Δ.Σ. ενημερώθηκε, η ενημέρωσε το  Δ.Σ.  τα  μέλη της αδελφότητας μας  για της επίπτωσης της ανάρτησης των δασικών χαρτών  δηλαδή, (  το να είναι δασικό το οικόπεδο η το χωράφι του). Υπήρξε συνεργασία με το τοπικό πρόεδρο  του χωριού ,ενημερώθηκε επίσημα από εκείνον  ότι αναρτώνται  δασική χάρτες για το χωριό και τυχών προτάσεις του ως τοπικού πρόεδρου.

    6. Σπουδαιότερο δε (κατά την άποψη μου ) γνώριζε έγγραφος η συμμετείχε έγγραφός με έγγραφο του το  απερχόμενου Δ.Σ. της αδελφότητος,  εφόσον είχε ενημερώθηκε προγενέστερα  από το πρόεδρο του χωρίου μας,  για την μη ένταξη και εξαίρεση ως μη ενδιαφέρον αλλά προοριζόμενη ως οικιστική περιοχή έκταση περίπου 150 στρωματά πέριξ του Αγ. Νικόλαου και τμήματος του καμπόπουλου συμπεριλαμβανομένου και τμήματος της τοποθεσία  τσομπάρι Μπουραντζή πάνω από  την βρύση κουραδά η τριαντάφυλλα  Πια η γνώμη- επίσημη τοποθέτηση  το απερχόμενου Δ.Σ.  για το ανωτέρω θέμα εφόσον υπάρχει η εξαίρεση της προηγούμενης παραγράφου  τον 150 περίπου στρεμμάτων και στην δημοσίευση και οριστική κατοχύρωση των δασικών χαρτών.

    ====================================================================

    Και επιτρέψτε μου ένα μικρό σχόλιο,

    (( θεωρώ σκανδαλώδης και προνομιακή αυτή την ενέργεια ,προνομιακή  γιατί κάποιοι συγχωριανή μας και μπράβο τους  απέκτησαν  οικόπεδα,  όντος αν δεν είχαν στα όρια του υπάρχοντος  χωρίου μας,  παρά το ότι καταφανέστατα και δίχως προσχήματα, μας διαιρεί εκ των προτέρων  Εξαιρώντας και διαχωρίζοντας μας  σε αμνούς και ερίφια )). Εκτός αν συμβαίνει  άλλο τη που δεν μπορεί να γνωρίζω η να καταλάβω τη σκοπιμότητα της αυτής καθαυτής  της ενέργειας. Λέγει.. και  διαλαλεί.. ο  πάνσοφο λαός μας με τα πάνσοφα  ρητά-γνωμικά του,   ((… τα γρόσια στα γρόσια.  Άλο λέει … η οικογενειοκρατία καλά κράτη  για ένα πιάτο φακή… μην περιμένεις από αυτόν  που σε έριξε στο κρεμώ να σου ρίξει το σχοινί  για να σε σώσει… μπρός στα τιμαλφή στα ξακρίδια  η δόξα…  δε θεωρώ και δεν θέλω  να πιστέψω, ότι  η συγκεκριμένη ενέργεια από οπού  και αν προέρχεται ότι ανταποκρίνεται στο περί δικαίου αίσθημα .

    ======================================================================

    1. ΣΥΜΦΩΝΑ ΜΕ ΤΟ ΚΑΤΑΣΤΑΤΙΚΟ η αδελφότητα και το εκτελεστικό  όργανο της  το Δ.Σ. υποχρεούνται να  τηρούν μια σειρά βιβλίων,  ΠΑΡΑΚΑΛΩ  ΝΑ  ΜΟΥ ΓΝΩΡΙΖΕΤΕ   πια βιβλία παρέλαβε  από το προηγούμενο  Δ.Σ.   παράδειγμα =παραλάβατε ναι η όχι  1.το βιβλίο μητρώο μελών , 2. το βιβλίο ταμείου  3. το βιβλίο συνεδριάσεων Δ.Σ. 4.βιβλιο περιουσιακών  στοιχειών  5.βιβλιο πρακτικών γ.σ.  6. Βιβλίο ελεγκτικής επιτροπής, η ότι τη άλλο  καθώς επίσης  να μου γνωρίσει   από πια χρονική περίοδο περιχούν  εγγραφές αντίστοιχα, χρονικές περιόδους, πια δηλαδή είναι η ακριβή ημερομηνία πρώτης εγγραφή που φέρει κάθε βιβλίο. Καθώς σύμφωνα με τα υπάρχοντα πρακτικά παράδοσης και παραλαβής απερχόμενου και νεοεκλεγέντος  συμβούλιου αν αναγράφονται στα πρακτικά παραλαβής τα βιβλία που παραδόθηκα όπως το σχετικό άρθρο του καταστατικού ορίζει.

    2. Γνωρίσετε μου παρακαλώ επίσης συμφώνα με το καταστατικό Στο τηρούμενο αρχείο της  αδελφότητος υπάρχουν παλιότερα πλήρη βιβλία  όπως  παράδειγμα η πρώτη συνεδρίαση του Δ.Σ.  το 1931 έτος  ιδρύσεως της  αδελφότητος …

    10.Προσφατα εκδόθηκε και διανεμήθηκε στα μέλη της αδελφότητος μας   ένα βιβλίο σε εγγραφή  από τον   συγχωριανό μας Παναγιώτη  Μπουραντζή  με έξοδα της αδελφότητος .

    …Παρακαλώ να με ενημερώστε:

    Α. Αν το συγκεκριμένο βιβλίο έχει την έγκριση του Δ.Σ.  της αδελφότητος, 1. πριν την αρχική  διόρθωση από τον έκδοτη του το πρωτοτύπου συγγραφικού έργου 2. μετά την διόρθωση του   πρωτοτύπου συγγραφικού έργου από τον έκδοτη .

    Β. Ελέγχτηκε το σύνολο του κειμένου και το φωτογραφικό περιεχόμενο  ως  προς το αληθές περιεχόμενο  από το τηρούμενο αρχείο της αδελφότης μας  και  τα υπάρχοντα βιβλία η  άλλο φωτογραφικό υλικό  που έχει υπό την κατοχή του  ως  ιστορικό αρχείο  από το Δ.Σ. της αδελφότητος πριν δοθεί η τελική έκκριση εκτύπωσης  η άπλα πληρώσαμε τα τυπογραφικά.

    Γ . Εφόσον, και αν,  το Δ.Σ. της αδελφότητος  δεν μπορεί να διασταυρώσει  σε αντιπαραβολή ΜΕ ΤΑ ΤΗΡΟΥΜΕΝΑ ΑΠΟ ΤΟ Δ.Σ ΤΗΣ ΑΔΕΛΦΟΤΗΤΟΣ  ΙΣΤΟΡΙΚΑ ΑΡΧΕΙΑ  ΤΗΣ ΑΔΕΛΦΟΤΗΤΟΣ τα γραφόμενα στο βιβλίο του συγχωριανού μας Παναγιώτη Μποσταντζή  να ζητήσει –παρακάλεση  των συγχωριανό μας να παραδώσει τα πρωτότυπα στοιχεία ( αρχικό σχέδιο  ιδιόχειρες σημείωσης , ) και να μας γνωρίσει της πηγές που άντλησε τα στοιχειά και τα αναγραφόμενα   και επισυναπτόμενα  από αυτόν στο βιβλίο του ΩΣΤΕ ΝΑ ΥΠΑΡΞΗ ΑΝΑΣΥΣΤΑΣΗ ΙΣΤΟΡΙΚΟΥ ΑΡΧΕΙΟΥ ΤΗΣ ΑΔΕΛΦΟΤΗΤΟΣ  .

    Δ. Ρωτάτε το απερχόμενο Δ.Σ. πόσα αντίτυπα τυπώθηκαν του συγκεκριμένο  βιβλίου πιο το χρηματικό ποσών που κατέβαλε η αδελφότητα  για την εκτύπωση του .

    Ε. Ρωτάτε το απερχόμενο άλλα και το επόμενο Δ.Σ. τα κάθε Είδους συγγραφικά και άλλα  δικαιώματα του βιβλίου που χρηματοδοτήσαμε μέσου του ταμείο της αδελφότητος ποιος τα κατέχει ,η μήπως  έχουν παραχωρηθεί και αν ναι που έχουν παραχωρηθεί και με πια διαδικασία.  Επισημαίνω  κατά την άποψη μου την πληρότητα του βιβλίου σε ορισμένα κεφάλαια του.  Επιστρέψτε μου όπως  να διατηρήσω της προσωπικές μου  επιφυλάξεις για τυχών  παντός νόμιμου δικαιώματος μου γενικά και συνολικά ως προ την  έκδοση το  συγκεκριμένου  βιβλίου .             

    1. Ενημερώθηκε το απερχόμενο Δ.Σ για της ενέργειες του τοπικού πρόεδρου μας  σχετικά με την ανέγερση νέου κοινοτικού καταστήματος στην κεντρική πλατεία του χωρίου.

    2. Ενημερώθηκε έγγραφος η με άλλο τρόπο το απερχόμενο Δ.Σ. για της εκδήλωσης και άλλες δραστηριότητες του τοπικού συλλόγου του χωρίου μας Αγ. Νικόλαος  και αν ναι τη είδους βοήθεια προσέφερε.

    3. Υπάρχει επίσημο πρακτικό το οποίο ΑΝΑΓΡΑΦΕΤΕ και αναγνωρίζει ότι το διαδικτυακό όνομα vasilopoulo.gr είναι ο επίσημος διαδικτυακός τόπος  της αδελφότητας μας, ημερομηνία πρακτικού.

    4. ΥΠΗΡΞΕ ΠΑΡΕΜΒΑΣΗ η πιο άπλα δόθηκε εντολή προφορική η γραπτή η άλλη έμμεση η άμεση παρότρυνση η λεκτική παράκληση η παρέμβαση από το απερχόμενο Δ .Σ. της αδελφότητος μας (η μέλος της αδελφότητος αν γνωρίζετε ) η έγινε από τυχαίο γεγονός η διακοπή  κατέβηκε  η σελίδα  vasilopoulo.gr. πιες η ενέργειες έχετε πραγματοποίηση μέχρι σήμερα ως απερχόμενο Δ.Σ. της αδελφότητος μας  μετά την διακοπή πτώση της σελίδας  VASILOPOYLO.GR ώστε να σταματήσει η δίκοπη το ονόματος   vasilopoulo.gr  και να  ανέβη επαναλειτουργήσω η σελίδα.

    5. Έχει παρθεί απόφαση από το απερχόμενο η από προηγούμενα Δ.Σ. της αδελφότητος που δεν συμφωνούν στην έκδοση νόμιμης άδειας εξόρυξης χαλικιού ΣΤΗΝ ΘΕΣΗ ΠΕΡΠΑΤΟΣ η αντίθετος στη έγγραφη σαφέστατη θετική άποψη  να ΛΕΙΤΟΥΡΓΗΣΕΙ  στην θέση περπατος  νόμιμο νταμάρι  εξόρυξης αδρανούς υλικού ( χαλίκι ).

    6. Κατά την διάρκεια της θητείας του απερχόμενου Δ.Σ. τι είδους  προσφορές παραχωρήθηκαν  η αγοραστήκαν  η δόθηκαν ως βοήθεια , χρηματικά έμβασμα , η άλλα είδη η υλικά και ποιο το συνολικό χρηματικά ποσών και που αναλυτικά παραχωρήθηκαν  .

    7. Τη γνωρίζει το Δ.Σ. της αδελφότητος για την προστάτιδα εικόνα του χωρίου μας που κατά παραδώσει ΠΑΡΑΔΙΝΟΤΑΝ  από γενεά σε γενιά ποιες η τυχών ενέργειες  έχουν  πραγματοποιηθεί.

    8. Έχει ενημερωθεί το Δ.Σ. της αδελφότητος αν ο δήμος Ζίτσας προτίθεται να οριοθετήσει επίσημος  τους κοινόχρηστους  δρόμους  του χωρίου, και αν γνωρίζετε αν το χωριό μας έχει ανεγνωρισμένο οικιστικό σχέδιο και αν ναι ποιο το φ.ε.κ.

    9. Πρόσφατα άλλα και παλιότερα έγινε συζήτηση για την μεταφορά του νεκροταφείου από την θέση που βρίσκετε  σήμερα έξω από το προαύλιο και σε άμεση συνέχεα από την εκκλησία των 12 Αποστολών και προστάτες του χωρίου μας πια η γνώμη του της αδελφότητος .

    10. Έχει συζήτηση το Δ.Σ. της αδελφότητος να απονέμη τα προβλεπόμενα από το καταστατικό εύσημα – παράσημα σε εκείνους που παραχώρησαν περιουσιακά τους στοιχεία ( π.χ. κτήματα η μέρος αυτών για διάνοιξη δρόμων) η άλλες ευεργετικές προσφορές.

    11. Γνωρίζει το Δ.Σ. της αδελφότητος αν υπάρξει, η αν υπάρχει , από κληρονόμους συγχωριανός  μας αποποίηση υπερεσιακών στοιχείων στα  διοικητικά  όριο του χωρίου .

    22.Επισης παρακαλώ οπός μου χορηγηθεί από το αρχείο της αδελφότητος  αντίγραφο του πρωτοτύπου καταστατικού του 1931 καθώς και αντίγραφα τον μέχρι σήμερα τροποποιήσεων.

                         Σας ευχαριστώ εκ των προτέρων  για  το σύντομο των απαντήσεων

                                                                        Φωτίου Στυ.  Βασίλειος

    ΣΗΜΕΙΩΣΗ: Αξιότιμε κύριε πρόεδρε  και σεβαστά μέλη του προεδρείου της Γ.Σ. παρακαλώ όπως  συμπεριλάβε  την παρούσα αίτηση αυτούσια στα πρακτικά της  Γ.Σ.  Σας ενημερώνω και γνωρίζω ότι  δε έχω καμία απόλυτος πρόθεση να εκθέσω η να θίξω κανένα προσωπικά ηθικά η οτιδήποτε άλλο  με τα παραπάνω στο σύνολο τους  γραφόμενα μου , άλλα η απάντησης που θα μου δοθούν από το Δ.Σ. της αδελφότητος μας  καθώς  και η παρούσα αίτηση αυτούσια θα συμπεριελήφθη σε ιστορική ανάδρομη του χωρίου που γράφω . Σας ευχαριστώ.

    *** ΠΡΟΤΑΣΗ  ΓΙΑ ΨΗΦΙΣΗ ΣΤΗΝ ΓΕΝΙΚΗ ΣΥΝΕΛΕΥΣΗ

    ΕΡΩΤΗΜΑ: Σύμφωνη το σώμα  στη εξόρυξη πετρελαίου στην περιοχή του Κατά παράδοση  Δήμου Ζίτσας : 1. ΝΑΙ ΣΥΜΦΩΝΩ ΣΤΗΝ ΕΞΟΡΥΞΗ ,  2. ΟΧΙ ΔΕ ΣΥΜΦΩΝΩ

    =====================================================

    Επανέρχομαι  και ρωτώ ευθέως:  είναι η δεν είναι οικιστική περιοχή  πέριξ του Αγ. Νικόλαου  όπως αυτή αποτυπώνετε  στους  κυρωθέντες δασικούς χάρτες ??? βλέπε ηλεκτρονική διεύθυνση παρακάτω. https://gis.ktimanet.gr/wms/forestfinal/default.aspx

     Ποιος έκανε την εισήγηση για την εξαίρεση των πενήντα στεμμάτων  βλέπε και σχετική επιστολή στην παρακάτω ηλεκτρονική διεύθυνση https://boskotsopanhs.wordpress.com/2017/02/22/%ce%b1%ce%bd%ce%bf%ce%b9%cf%87%cf%84%ce%b7-%ce%b5%cf%80%ce%b9%cf%83%cf%84%ce%bf%ce%bb%ce%b7-%cf%80%cf%81%ce%bf%cf%83-%ce%ba%ce%b1%ce%b8%ce%b5-%ce%b1%cf%81%ce%bc%ce%bf%ce%b4%ce%b9%ce%bf-%cf%80%cf%81/

    Προστεθήκαν στης 28-07-2018 για πληρέστερη ενημέρωση

    Οικιστική περιοχή  πέριξ του Αγ. Νικόλαου

    mh DASILOY ENDIAFERONTOS EKTASI STO AG.NIKOLAO KINOS IKISTIKI EMBADON KATA prosegkisi

    Οικιστική περιοχή Βασιλοπούλου πέριξ του Αγ. Νικόλαου

    KASTRI SIOYTISTA ektasi se t.m (2)

    ektasi basilopoylo kata prosegkisi

    Εξαίρεση των πενήντα στεμμάτων πέριξ του Αγ. Νικόλαου

    mh DASILOY ENDIAFERONTOS EKTASI STO AG.NIKOLAO KINOS IKISTIKI EMBADON KATA prosegkisi

    Καστρί (σιούτιστα) εκταση σε τ.μ.

    KASTRI SIOYTISTA ektasi se t.m (1)

     

     
  • lithari 7:46 pm on 28/07/2018 Μόνιμος σύνδεσμος |  

    Επανέρχομαι και ρωτώ ευθέως: είναι η δεν είναι οικιστική περιοχή πέριξ του Αγ. Νικόλαου όπως αυτή αποτυπώνετε στους κυρωθέντες δασικούς χάρτες ??? βλέπε ηλεκτρονική διεύθυνση παρακάτω…ΑΝΟΙΧΤΗ ΕΠΙΣΤΟΛΗ ΠΡΟΣ ΚΑΘΕ ΑΡΜΟΔΙΟ ΠΡΟΣΩΠΟ Η ΦΟΡΕΑ…. Μου έχουν δημιουργηθεί μερικά ερωτήματα και απορίες σχετικά με τους δασικούς χαρακτηρισμούς και τις εξαιρέσεις στα διοικητικά όρια του χωριού μας. Τα ερωτήματα και τις απορίες μου αυτές τις υποβάλω προς κάθε αρμόδιο του δημοτικού διαμερίσματος Βασιλόπουλου ,στον δήμο Ζίτσας αλλά και στους συγχωριανούς μου…. 

    Επανέρχομαι  και ρωτώ ευθέως:  είναι η δεν είναι οικιστική περιοχή  πέριξ του Αγ. Νικόλαου  όπως αυτή αποτυπώνετε  στους  κυρωθέντες δασικούς χάρτες ??? βλέπε ηλεκτρονική διεύθυνση παρακάτω.

    https://gis.ktimanet.gr/wms/forestfinal/default.aspx

     Ποιος έκανε την εισήγηση για την εξαίρεση των πενήντα στεμμάτων  βλέπε και σχετική επιστολή στην παρακάτω ηλεκτρονική διεύθυνση

    https://boskotsopanhs.wordpress.com/2017/02/22/%ce%b1%ce%bd%ce%bf%ce%b9%cf%87%cf%84%ce%b7-%ce%b5%cf%80%ce%b9%cf%83%cf%84%ce%bf%ce%bb%ce%b7-%cf%80%cf%81%ce%bf%cf%83-%ce%ba%ce%b1%ce%b8%ce%b5-%ce%b1%cf%81%ce%bc%ce%bf%ce%b4%ce%b9%ce%bf-%cf%80%cf%81/

    Προστεθήκαν στης 28-07-2018 για πληρέστερη ενημέρωση

    Οικιστική περιοχή  πέριξ του Αγ. Νικόλαου

    mh DASILOY ENDIAFERONTOS EKTASI STO AG.NIKOLAO KINOS IKISTIKI EMBADON KATA prosegkisi

    Οικιστική περιοχή Βασιλοπούλου πέριξ του Αγ. Νικόλαου

    KASTRI SIOYTISTA ektasi se t.m (2)

    ektasi basilopoylo kata prosegkisi

    Εξαίρεση των πενήντα στεμμάτων πέριξ του Αγ. Νικόλαου

    mh DASILOY ENDIAFERONTOS EKTASI STO AG.NIKOLAO KINOS IKISTIKI EMBADON KATA prosegkisi

    Καστρί (σιούτιστα) εκταση σε τ.μ.

    KASTRI SIOYTISTA ektasi se t.m (1)

    =====================================================================

    ΑΝΟΙΧΤΗ ΕΠΙΣΤΟΛΗ ΠΡΟΣ ΚΑΘΕ ΑΡΜΟΔΙΟ ΠΡΟΣΩΠΟ Η ΦΟΡΕΑ…. Μου έχουν δημιουργηθεί μερικά ερωτήματα και απορίες σχετικά με τους δασικούς χαρακτηρισμούς και τις εξαιρέσεις στα διοικητικά όρια του χωριού μας. Τα ερωτήματα και τις απορίες μου αυτές τις υποβάλω προς κάθε αρμόδιο του δημοτικού διαμερίσματος Βασιλόπουλου ,στον δήμο Ζίτσας αλλά και στους συγχωριανούς μου ως τροφή για σκέψη αλλά και τυχών προβληματισμό….

    ΑΝΟΙΧΤΗ ΕΠΙΣΤΟΛΗ ΠΡΟΣ ΚΑΘΕ ΑΡΜΟΔΙΟ ΠΡΟΣΩΠΟ Η ΦΟΡΕΑ

     

    Αθήνα , 21-02-2017

    Η  δασικοί  χάρτες   έχουν αναρτηθεί, η δε  δίμηνη προθεσμία  υποβολής ενστάσεων εντός των ημερών  αρχίζει να κυλάει αντίστροφα .

    Μου έχουν δημιουργηθεί  μερικά ερωτήματα και απορίες   σχετικά με τους δασικούς  χαρακτηρισμούς και τις εξαιρέσεις  στα διοικητικά όρια του χωριού μας. Τα ερωτήματα και τις απορίες μου αυτές τις υποβάλω   προς κάθε αρμόδιο του δημοτικού διαμερίσματος Βασιλόπουλου ,στον  δήμο Ζίτσας αλλά και στους συγχωριανούς μου ως τροφή για σκέψη αλλά και τυχών προβληματισμό.

        Αρχικά θα ήθελα να ρωτήσω,  Α: αν έγινε εις γνώση  του   πρόεδρου του τοπικού διαμερίσματος  Βασιλόπουλου  αλλά και του   δήμου Ζίτσας η  μη χαρακτηρισμένη  περιοχή  όπως αυτή αναφέρετε και περιχαρακώνετε –αποτυπώνετε  στου αναρτώμενους  δασικούς χάρτες στον  Αγ. Νικόλαο (όπως αναγράφεται στον χάρτη  1 με κόκκινο περίγραμμα  για συντομία= περιμετρικά του Αγ. Νικόλαου;).

         Β: Αν όντως έγινε εις γνώση του προέδρου και εφόσον το γνώριζε και το τοπικό κοινοτικό συμβούλιο του τοπικού  διαμερίσματος  Βασιλόπουλου ,με ποιά κριτήρια προχώρησε στην  ενέργεια εξαίρεσης του χώρου περιμετρικά του  Αγ. Νικόλαου  όπως αυτός αποτυπώνετε   στον δασικό χάρτη;.

        Γ: Γνώριζε ο Δήμος Ζίτσας και το τοπικό κοινοτικό συμβούλιο Βασιλόπουλου ότι: Ο  μη χαρακτηρισμός , η εξαίρεση δηλαδή  περιμετρικά  του Αγίου Νικόλαου αυτή καθεαυτή  έχει ευνοϊκότατα  και σκανδαλώδη ευεργετήματα και κατ‘ επέκταση χαριστικές απολαβές – παροχές ( όπως πχ οικονομικές και όχι μονό )για τους ιδιοκτήτες των οικοπέδων , του υπό εξαίρεση –μη χαρακτηρισμένου τμήματος περιμετρικά  του Άγιου Νικόλαου του διοικητικού διαμερίσματος  Βασιλόπουλου του κατά παράδοση δήμου Ζίτσας ;.

       Εφόσον  έχει γίνει  παρέμβαση , για  την υπό εξαίρεση –μη χαρακτηρισμό του τμήματος περιμετρικά  του Αγίου Νικόλαου από τον  κατά παράδοση Δήμο Ζίτσας, η το τοπικό κοινοτικό πρόεδρο  και εσείς  ζητείται   την εξαίρεση του συγκεκριμένου τμήματος περιμετρικά του Αγ. Νικόλαου, αιτούμε όπως μου απαντήσετε στα ακόλουθα ερωτήματα (Γ,Δ,Ε,Z,Η,θ)αλλά και όπως μου  παραθέσετε τα ακόλουθα έντυπα (Α & Β):

    Α:Tο πλήρες κείμενο  των  αιτήσεων περί τις εξαιρέσεως εκτάσεων περιμετρικά  του Αγ. Νικόλαου (σε όποιο αρμόδιο ή άλλη δημόσια αρχή  την έχετε υποβάλει).

     Β: Το ΑΚΡΙΒΕΣ και πλήρες  αντίγραφο του  Φακέλου( εφόσον υπάρχει )  που συνόδεψε την αίτηση σας, και εφόσον υπάρχει  φάκελος   το ακριβές οικονομικό τίμημα του φάκελου, από  ποιόν κωδικό έγινε η εκταμίευση  των χρημάτων και πληρωθήκαν οι όποιες  μελέτες σχεδία και λοιπά έγραφα ή τυχών προσωπικά εντάλματα πληρωμών ή τυχών συμφωνητικά απευθείας ανάθεσης .

      Γ: ήταν εις γνώση σας η ενέργεια αυτή; Ενεργήσατε δηλαδή εσείς   για την υπό εξαίρεση του χώρου περιμετρικά του Αγ. Νικόλαου; και αν ναι , υπάρχει σύμφωνη γνώμη των ιδιοκτητών και συνιδιοκτητών  δεδομένη της  υπεραξίας τους  στην εξαίρεση του συγκεκριμένου τμήματος περιμετρικά του Αγ. Νικόλαου; Υπάρχει εγράφη συγκατάθεση τους;  ή έγινε εν αγνοία τους, ως προ το κοινωνικό όφελος;.  

       Δ : Ποιά είναι η θέση του τοπικά εκλεγμένου πρόεδρου  στο  γεγονότος  ότι: κτήματα, και γεωργικές εκτάσεις των συγχωριανών  και ετεροδημοτών στα διοικητικά όρια του  διαμερίσματος  Βασιλόπουλου του κατά παράδοση δήμου Ζίτσας  χαρακτηρίζονται  πλέον ως ΔΑΣΙΚΕΣ  με ότι αυτό συνεπάγεται;

       Ε. Προτίθεται ο άρχον μεταξύ ίσων του χωριού μας, ο πρόεδρος της κοινότητας μας,  να υποστηρίξει  έμπρακτα  τους συγχωριανούς τόσο ώστε να αναγνωριστούν-αποχαρακτηριστούν  τα  κτήματα τους ως μή δασικά; αλλά όσο και για να τους παραχωρηθούν τίτλοι  των δασών που δικαιωματικά  τους ανήκουν;  μιας και έχουν χρυσοπληρωθεί  από του προγονούς μας  ( βλέπε σχετικά ανοιχτή επιστολή που μέχρι σήμερα δεν έχει απαντηθεί).

    Ζ: Σε  περίπτωση κατά την όποια  έγινε μη  χαρακτηρισθείσα  η περιοχή περιμετρικά του Αγ. Νικόλαου  όπως αυτή αποτυπώνεται  στον υπό ανάρτηση δασικό χάρτη χωρίς να έχει  γνώση   ο δήμος Ζίτσας αλλά ούτε και ο πρόεδρος του διαμερίσματος  Βασιλόπουλου,  θα ήθελα να μου απαντήσετε  αν   συγκατατίθεστε –συνυπογράφετε  την αίτηση  προς κάθε  αρμόδια αρχή ώστε να καταργηθεί ο μη χαρακτηρισμός της περιοχής  περιμετρικά του Αγ. Νικόλαου  όπως αυτή αποτυπώνετε στον υπό ανάρτηση δασικό χάρτη ΝΑΙ;.

    Η.  Προτίθεται ο κατά παράδοση δήμος Ζίτσας αλλά  και ο τοπικός  πρόεδρος  να  προχωρήσουν  στις απαιτούμενες κατά τον νομό πράξεις – ενέργειες έτσι ώστε  να   αναγνωριστεί  ως εκμεταλλεύσιμο (νταμάρι- ορυχείο)  το φυσικό κοίτασμα  εξόρυξης  χαλικιού στην θέση περπατός ;  ώστε η κοινότητα  να αποκτήσει ένα  μόνιμο και σταθερό έσοδο καλύπτοντας τις οικονομικές  ανάγκες της στα απαιτούμενα σχεδία του τοπικού έκαστου  πρόεδρου της κοινότητας μας (εφόσον και αν δεν εμπίπτει στην ισχύουσα νομοθεσία για ξεχωριστή οικονομική διαχείριση ). 

    θ: Προτίθεστε αξιότιμε κύριε πρόεδρε του κοινοτικού διαμερισμός Βασιλόπουλου να υποβάλετε την προβλεπόμενη κατά νομό αίτηση για  αποχαρακτηρισμό  κοινοτικής περιουσίας που έχει χαρακτηριστεί ως δασική;

    Σε αυτό το σημείο θα ήθελα να επισημάνω ότι οι όποιες ενέργειες για τον όποιο αποχαρακτηρισμό πρέπει να επιτύχουν. Για  να γίνει αυτό απαιτείται η  συμμετοχή, η σύμπνοια  αλλά και η αμοιβαία  υποχώρηση   όλων υμών και ημών τον συγχωριανών  και όχι μονό, έτσι ώστε  να προκύψει μια βιώσιμη και σταθερή λύση προ όφελος όλων μας και κατ’ επέκταση και του δημόσιου συμφέροντος, πιστεύοντας  και ευελπιστώντας ότι δεν θα επικρατήσει η άποψη των μιασμάτων και των εριφιών .

    Τέλος θα ήθελα να ξεκαθαρίσω ότι, η παρούσα επιστολή δεν έχει σε καμία περίπτωση  το σκοπό  να προσβάλει  η να θίξει κανένα  φυσικό πρόσωπο η θεσμό η κρατικό φορέα. Ο  σκοπός της είναι καθαρά και μονό να επέλθει μια ολοκληρωμένη και σαφή ενημέρωση  αλλά και κάποιες  απαντήσεις  τόσο σε εμένα όσο και στους συγχωριανούς μου .

     Με εκτίμηση ,

    Φωτίου Σ. Βασίλειος

    ΔΑΣΙΚΟΣ ΧΑΡΤΗΣ ΟΠΩΣ ΑΥΤΟ ΑΠΟΤΥΠΩΝΕΤΕ  ΣΤΗΝ ΣΕΛΙΔΑ  ΤΟΥ ΕΘΝΙΚΟΥ ΚΤΗΜΑΤΟΛΟΓΙΟΥ ΚΑΙ ΧΑΡΤΟΓΡΑΦΗΣΗΣ . Κλικ επάνω στο χάρτη για να μεταφερθείτε στην επίσημη σελίδα  του  εθνικού κτηματολογίου και χαρτογράφησης.

    xartis-1-basilopoyloy

    ΧΑΡΤΗΣ 1

    …Ηταν εις γνώση σας η ενέργεια αυτή; Ενεργήσατε δηλαδή εσείς για την υπό εξαίρεση του χώρου περιμετρικά του Αγ. Νικόλαου; και αν ναι , υπάρχει σύμφωνη γνώμη των ιδιοκτητών και συνιδιοκτητών δεδομένη της υπεραξίας τους στην εξαίρεση του συγκεκριμένου τμήματος περιμετρικά του Αγ. Νικόλαου; Υπάρχει εγράφη συγκατάθεση τους; ή έγινε εν αγνοία τους, ως προ το κοινωνικό όφελος;

    Μη χαρακτηρισμένη περιοχή περιμετρικά του Αγίου Νικόλαου.

     
  • lithari 3:03 pm on 28/07/2018 Μόνιμος σύνδεσμος |  

    Το σημερινό δημαρχοκεντρικό σύστημα επιχειρείται να καταργηθεί με τον «Καλλικράτη» με τη σύσταση νέων δομών. Στα πρότυπα της κυβερνητικής επιτροπής θα λειτουργεί Εκτελεστική Επιτροπή αποτελούμενη από τον δήμαρχο και τους αντιδημάρχους, αρμόδια για όλους τους τομείς πολιτικής. ΤΙ ΣΥΓΚΕΚΡΙΜΕΝΑ ΑΛΛΑΖΕΙ Ο ΝΟΜΟΣ ΚΑΛΛΙΚΡΑΤΗ…. 

    ΤΙ ΣΥΓΚΕΚΡΙΜΕΝΑ ΑΛΛΑΖΕΙ Ο ΝΟΜΟΣ ΚΑΛΛΙΚΡΑΤΗ

    Το σημερινό δημαρχοκεντρικό σύστημα επιχειρείται να καταργηθεί με τον «Καλλικράτη» με τη σύσταση νέων δομών.
    Στα πρότυπα της κυβερνητικής επιτροπής θα λειτουργεί Εκτελεστική Επιτροπή αποτελούμενη από τον δήμαρχο και τους αντιδημάρχους, αρμόδια για όλους τους τομείς πολιτικής.


    Τα οικονομικά του δήμου θα περνούν πλέον από τη δικαιοδοσία της Οικονομικής Επιτροπής, η οποία θα απαρτίζεται από τον αρμόδιο αντιδήμαρχο και από 6 έως 10 μέλη ανάλογα με το μέγεθος του δημοτικού συμβουλίου. Ανάλογος θα είναι ο τρόπος συγκρότησης της Επιτροπής Ποιότητας Ζωής, που προβλέπεται για δήμους άνω των 10.000 κατοίκων και θα αναλάβει ζητήματα χωροταξίας, πολεοδομίας και προστασίας του περιβάλλοντος.
    Γνωμοδοτικό όργανο σε δήμους πάνω από 10.000 κατοίκους θα είναι η νέα Δημοτική Επιτροπή Διαβούλευσης, αποτελούμενη από 25 έως 50 μέλη- εκπροσώπους φορέων της τοπικής κοινωνίας και δημότες. Καταγγελίες και αναφορές πολιτών για κακοδιοίκηση στους δήμους θα δέχεται ο Συμπαραστάτης του Δημότη και της Επιχείρησης, ο οποίος θα είναι πρόσωπο κύρους και θα επιλέγεται σε δήμους άνω των 20.000 κατοίκων από τα 2/3 του δημοτικού συμβουλίου.
    Παράλληλα, ο νόμος προβλέπει ειδικό πρόγραμμα εξυγίανσης στο οποίο θα μπορούν να ενταχθούν όσοι δήμοι έχουν υποχρεώσεις ή χρέη τα οποία υπερβαίνουν συγκεκριμένο ποσοστό των ετήσιων τακτικών εσόδων τους. Η χρηματοδότηση του προγράμματος εξυγίανσης θα γίνει μέσω ειδικού Λογαριασμού Εξυγίανσης και Αλληλεγγύης της Αυτοδιοίκησης, που θα συσταθεί στο Ταμείο Παρακαταθηκών και Δανείων.
    Στο πλαίσιο της βελτίωσης των υπηρεσιών προς τον πολίτη το πρόγραμμα προβλέπει μια σειρά καινοτόμων αλλαγών, όπως είναι, π.χ., η «έξυπνη» κάρτα δημότη και τα 1.200 ηλεκτρονικά δημοτικά ΚΕΠ.
    Με περισσότερες από 220 αρμοδιότητες φαίνεται ότι θα ενισχυθούν οι δήμοι μετά τον «Καλλικράτη», ενώ για τις περιφερειακές αυτοδιοικήσεις το σχέδιο προβλέπει τη μεταφορά 304 νέων αρμοδιοτήτων. Αποτέλεσμα της αναδιάρθρωσης αυτής των αρμοδιοτήτων θα είναι και οι μαζικές μετακινήσεις προσωπικού, ενώ οι Δήμαρχοι ανησυχούν και θεωρούν τους πόρους ανεπαρκείς και αβέβαιους ως προς την είσπραξή τους , παρά τις δεσμεύσεις του Υπ. Εσωτερικών ότι οι νέες αρμοδιότητες θα συνοδεύονται από τους αντίστοιχους πόρους.
    Συγκεκριμένα,ο νόμος <<Καλλικράτη>> προβλέπει: 1) Συνολική ετήσια εξοικονόμηση 1.185.000.000 ευρώ από τον περιορισμό λειτουργικών δαπανών και την ορθολογική αξιοποίηση υπαρχόντων πόρων. Επιπλέον εξοικονόμηση 75.000.000 ευρώ ανά εκλογική περίοδο λόγω της σύμπτωσης με τις ευρωεκλογές. Για παράδειγμα, ο αριθμός των δημοτικών συμβούλων από 16.150 που είναι σήμερα περιορίζεται στους μισούς περίπου. Οι 195 θέσεις Αντινομαρχών αντικαθίστανται από τις μισές Αντιπεριφερειαρχών και οι 1.496 νομαρχιακοί σύμβουλοι αντικαθίστανται από 703 περιφερειακούς συμβούλους. Συνολικά οι περισσότερες από 50.000 θέσεις πολιτικού προσωπικού μειώνονται σε 25.000 θέσεις. Μόνο από τη μείωση αυτών των θέσεων πραγματοποιείται εξοικονόμηση της τάξης του 60%.

    2) Τα 6.000 ΝΠΔΔ και επιχειρήσεις των Δήμων που υπάρχουν σήμερα περιορίζονται σε λιγότερα από 2.000 ( Άρθρα 194-204 του νόμου). Τα 60.000 περίπου μέλη των διοικήσεων μειώνονται κατά 40.000 σε 20.000 μέλη Διοικητικών Συμβουλίων δημοτικών επιχειρήσεων. Δημιουργείται ένα πλαίσιο διαφανούς και ορθολογικής λειτουργίας των δημοτικών επιχειρήσεων και των ΝΠΔΔ αντίστοιχα.

    3) Οι εκλογές πλέον γίνονται κάθε (5) χρόνια μαζί με τις ευρωεκλογές, (άρθρα 9 και 114–η πενταετία θα εφαρμοσθεί απο τις επόμενες εκλογές και όχι από τις ερχόμενες).Δίνεται περισσότερος ωφέλιμος χρόνος σε κάθε αυτοδιοικητική αρχή να εφαρμόσει τις πολιτικές της. Εκτός από τις προφανείς εξοικονομήσεις από την ταυτόχρονη διεξαγωγή των εκλογών, δημιουργούνται συνθήκες και για μεγαλύτερη συμμετοχή στις ευρωεκλογές.

    4) Μεταφέρεται στην Περιφέρεια το σύνολο των αρμοδιοτήτων, που αφορούν τον αναπτυξιακό περιφερειακό προγραμματισμό. Στην αρμοδιότητα αυτή εντάσσεται όχι μόνον η κατάρτιση και εκτέλεση των Περιφερειακών Επιχειρησιακών Προγραμμάτων, αλλά και η συμμετοχή στην όλη διαδικασία, κατάρτισης και εφαρμογής του Εθνικού Στρατηγικού Πλαισίου αναφοράς (Ε.Σ.Π.Α.) για την προγραμματική περίοδο 2007-2013. (άρθρο 186Α). Οι αυτοδιοικούμενες Περιφέρειες γίνονται το θεσμικό όχημα της πράσινης ανάπτυξης.

    5) Οι Δήμοι αποκτούν αρμοδιότητες που σχετίζονται με τοπικά ζητήματα όπως η έκδοση οικοδομικών αδειών, η κοινωνική πρόνοια και επαγγελματικές άδειες. Οι πολίτες εξυπηρετούνται άμεσα για ζητήματα που αφορούν την καθημερινότητά τους.

    6) Οι Περιφέρειες αποκτούν ευρύτατες αρμοδιότητες που αποκεντρώνονται από υπουργεία, όπως ο αναπτυξιακός σχεδιασμός, η Δημόσια Υγεία και η κατασκευή έργων.

    7) Τίθενται προϋποθέσεις και διαδικασίες για τη λήψη δανείου από τους ΟΤΑ. (άρθρο 264). Για να μην υπάρξουν στο μέλλον ξανά περιπτώσεις υπερδανεισμένων Δήμων καθιερώνονται αυστηρά όρια και κριτήρια δανεισμού. Γιατί οι υπερβολικοί αυτοί δανεισμοί δεν έχουν αντίκτυπο μόνο στα χρέη κάθε δήμου, αλλά συνυπολογίζονται και στο δημόσιο χρέος της χώρας μας.

    8) Θεσμοθετείται ειδικό πρόγραμμα εξυγίανσης στο οποίο υπάγονται οι υπερχρεωμένοι Δήμοι, (άρθρο 262). Στις περιπτώσεις που η εξυγίανση αφορά μόνο έναν από τους ΟΤΑ που συνενώνονται, το πρόγραμμα εφαρμόζεται για τον συγκεκριμένο συνενούμενο υπερχρεωμένο δήμο που αποτελεί μέρος του νέου καλλικράτειου Δήμου.

    9) Οι δαπάνες όλων των δήμων και των περιφερειών, όλων των νομικών προσώπων και των επιχειρήσεων τους, υπάγονται στον προληπτικό έλεγχο του Ελεγκτικού Συνεδρίου, (άρθρο 275). Για να μην ξοδεύεται ούτε ένα ευρώ με αδιαφανείς διαδικασίες. Μέχρι σήμερα 500 Δήμοι δεν υπάγονταν στον προληπτικό έλεγχο του Ελεγκτικού Συνεδρίου. Μέχρι σήμερα καμία επιχείρηση ή ΝΠΔΔ δεν υπαγόταν στον προληπτικό έλεγχο του Ελεγκτικού Συνεδρίου.

    10) Το Ελεγκτικό Συνέδριο πραγματοποιεί γενικευμένο προσυμβατικό έλεγχο νομιμότητας σε συμβάσεις άνω των 100.000 ευρώ την οποία συνάπτουν οι δήμοι, οι περιφέρειες και τα νομικά τους πρόσωπα καθώς και οι επιχειρήσεις τους, (άρθρο 278). Μέχρι σήμερα ο προσυμβατικός έλεγχος πραγματοποιείτο μόνο για συμβάσεις άνω του 1.000.000 ευρώ και δεν αφορούσε ΝΠΔΔ και επιχειρήσεις της αυτοδιοίκησης.

    11) Ο ελεγκτής νομιμότητας, που προΐσταται της Αυτοτελούς Υπηρεσίας Εποπτείας Ο.Τ.Α., είναι ανώτατος υπάλληλος με πενταετή θητεία. Η επιλογή του γίνεται από το Ειδικό Συμβούλιο Επιλογής Προϊσταμένων (ΕΙ.Σ.Ε.Π.), (άρθρο 216). Μέχρι σήμερα τον έλεγχο νομιμότητας ασκούσε ο Γενικός Γραμματέας της Περιφέρειας, μετακλητός υπάλληλος δηλαδή, διορισμένος από την εκάστοτε κυβέρνηση.

    12) Κάθε αρμοδιότητα, κάθε εξουσία πλησιάζει τον πολίτη στο εγγύτερο δυνατό σημείο. Σε κάθε συνενούμενο δήμο παραμένει το σύνολο των υπηρεσιών ενώ προβλέπεται αντιδήμαρχος που θα μεριμνά για τις τοπικές υποθέσεις. Θεσμοθετούνται αντιδήμαρχοι και αντιπεριφερειάρχες με τοπική αρμοδιότητα, (άρθρα 59 και 160 αντίστοιχα).

    13) Συστήνονται παντού Τοπικές και Δημοτικές Κοινότητες που αντικαθιστούν τα σημερινά Τοπικά και Δημοτικά Διαμερίσματα. (άρθρα 79,80-93). Γιατί η Κοινότητα, Δημοτική (πάνω από 2.000 κατοίκους) και Τοπική (κάτω από 2.000 κατοίκους), είναι το κύτταρο των νέων ισχυρών Δήμων που αναζωογονεί ο «Καλλικράτης». Επιπλέον ενισχύεται η ενδοδημοτική αποκέντρωση με την απόδοση ενισχυμένων αρμοδιοτήτων στις κοινότητες.

    14) Oι νέοι μπορούν να εκλέγονται και να συμμετέχουν ενεργά στα κοινά από 18 ετών. Αίρεται το ελάχιστο του 21ου έτους για συμμετοχή στις εκλογές της τοπικής αυτοδιοίκησης. (άρθρο 13). Στόχος να δώσουμε στους νέους από 18 ετών την ευκαιρία να διαμορφώσουν το μέλλον του τόπου τους.

    15) Καθιερώνεται ο θεσμός του «Συμπαραστάτη του Δημότη και της Επιχείρησης» σε κάθε Δήμο και Περιφέρεια με αποστολή την έγκαιρη καταπολέμηση της κακοδιοίκησης, τη διασφάλιση της αμεροληψίας των αυτοδιοικητικών αρχών, τη βελτίωση της εξυπηρέτησης των πολιτών και των επιχειρήσεων, καθώς και την αποσυμφόρηση αιρετών οργάνων του δήμου και της περιφέρειας από τη συσσώρευση αιτημάτων και παραπόνων των πολιτών, (άρθρο 77).

    16) Στους Δήμους και τις Περιφέρειες συστήνεται Επιτροπή Διαβούλευσης. Η Επιτροπή Διαβούλευσης προσφέρει για πρώτη φορά τη δυνατότητα συγκροτημένης, θεσμοποιημένης και ανοικτής συμμετοχής και ανταλλαγής επιχειρημάτων με εκπροσώπους της τοπικής κοινωνίας, (άρθρο 76).

    17) Δημιουργούνται δίπλα στα σημερινά 1.000 ΚΕΠ άλλα 1.200 επιπλέον «Δημοτικά e-ΚΕΠ», σε κάθε γειτονιά ή χωριό ανάλογα με τις ανάγκες εξυπηρέτησης, με τα οποία παρέχονται διοικητικές υπηρεσίες όσο το δυνατόν εγγύτερα στο πολίτη.

    18) Συστήνεται αρμόδια υπηρεσία(π.χ. δημοτικός ταχυδρόμος) υπεύθυνη για την παροχή διοικητικής βοήθειας σε άτομα που έχουν αντικειμενική αδυναμία προσπέλασης στους δήμους ή στα ΚΕΠ, (άρθρο 98), για όλους τους ανθρώπους που δεν έχουν τη δυνατότητα να μετακινηθούν ή να χρησιμοποιήσουν τα σύγχρονα δημοτικά e-ΚΕΠ.

    19) Εισάγεται η έξυπνη «κάρτα του Δημότη», ξεκινά η υλοποίηση της «κάρτας του πολίτη». Για την άμεση ηλεκτρονική εξυπηρέτηση του πολίτη και έκδοση πιστοποιητικών αλλά και για συμμετοχή σε τοπικά δημοψηφίσματα.

    20) Για κάθε όργανο των Δήμων, και όλων των Νομικών Προσώπων τους εισάγεται υποχρέωση ανάρτησης κάθε απόφασής τους στο διαδίκτυο, προκειμένου αυτή να είναι εκτελεστή, (άρθρο 71). Πλήρης διαφάνεια σε όλες τις αποφάσεις, ίση πρόσβαση στην πληροφορία για όλους τους πολίτες. Για να γνωρίζει ο πολίτης πού πηγαίνει κάθε ευρώ από τη φορολόγησή του.

    ΤΙ  ΑΛΛΑΖΕΙ ΣΤΙΣ ΠΕΡΙΦΕΡΕΙΕΣ:1. Το σύστημα διακυβέρνησης

    Τι  ίσχυε μέχρι χθες: Τι αλλάζει με το νόμο <<Καλλικράτη>>:
    Ο Νομάρχηςσυγκέντρωνε στο πρόσωπό του σχεδόν το σύνολο των εξουσιών Η Εκτελεστική Επιτροπή αποτελείται από τον Περιφερειάρχη και τους Αντιπεριφερειάρχες, γίνεται το συλλογικό όργανο άσκησης, συντονισμού και λογοδοσίας της εκτελεστικής λειτουργίας της Περιφέρειας. Με τον τρόπο αυτό περιορίζεται η συγκέντρωση εξουσίας στο πρόσωπο του Περιφερειάρχη και ενισχύεται η συλλογική λειτουργία της Περιφέρειας.
    Οι αντινομάρχες ήταν αποκλειστικάθεματικοί. Αντιπεριφερειάρχες  με τοπική αρμοδιότητα. Με τον τρόπο αυτό διασφαλίζεται η μέριμνα για τα ιδιαίτερα τοπικά ζητήματα της περιφερειακής ενότητας.
    Η Νομαρχιακή Επιτροπή αποτελούσε εκτελεστικό όργανο μεδιάφορες αρμοδιότητες Η Νομαρχιακή Επιτροπή μετονομάζεται σε Οικονομική και  αναβαθμίζεται, ως προς τις λειτουργίες  οικονομικού ελέγχου και τακτικής παρακολούθησης της υλοποίησης του προϋπολογισμού.
    Οι αποφάσεις  του Νομάρχη, του Νομαρχιακού Συμβουλίου και των ΝΠΔΔ της Νομαρχίας δημοσιεύονταν στο κατάστηματης νομαρχίας Όλες οι αποφάσεις  των συλλογικών οργάνων των Περιφερειών  καθώς και όλων των νομικών  τους προσώπων υποχρεωτικά δημοσιεύονται  στο διαδίκτυο, σε διαφορετική περίπτωση απλά δεν ισχύουν.

    2. Διαβούλευση

    Τι  ίσχυε μέχρι χθες: Τι  αλλάζει με το νόμο <<Καλλικράτη>>:
    Δεν υπήρχεκάποιος θεσμός που να δίνει τη δυνατότητα οργανωμένης διαβούλευσης και έκφρασης των τοπικών φορέων. Καθιερώνεται η  Επιτροπή Διαβούλευσης. Η Επιτροπή Διαβούλευσης προσφέρει τη δυνατότητα συγκροτημένης, θεσμοποιημένης και ανοικτής συμμετοχής και ανταλλαγής επιχειρημάτων με εκπροσώπους της τοπικής κοινωνίας.
    Τα μέλη του συμβουλίου της Επιτροπής Διαβούλευσης προέρχονται  κατά 1/3 από πολίτες μετά από κλήρωση  και από τους παραγωγικούς φορείς της Περιφέρειας (Εκπρόσωποι Εργαζομένων, Επιχειρήσεων, Επιστημονικοί Σύλλογοι, Αθλητικοί – Πολιτιστικοί Σύλλογοι)
    Ο πολίτης  που είχεπαράπονα από τις υπηρεσίες της Νομαρχίας απευθυνόταν κυρίως στο Νομάρχη. Καθιερώνεται ο  θεσμός του «Συμπαραστάτη του Πολίτη και της Επιχείρησης» με αρμοδιότητα την έγκαιρη καταπολέμηση της κακοδιοίκησης, τη διασφάλιση της αμεροληψίας των περιφερειακών αρχών, τη βελτίωση της εξυπηρέτησης των πολιτών και των επιχειρήσεων, καθώς και την αποσυμφόρηση του Περιφερειάρχη και άλλων αιρετών οργάνων της Περιφέρειας από τη συσσώρευση αιτημάτων και παραπόνων των πολιτών.

    3. Τα οικονομικά  των αυτοδιοικούμενων  Περιφερειών

    Τι  ίσχυε μέχρι χθες: Τι  αλλάζει με το νόμο <<Καλλικράτη>>:
    Οι Νομαρχίες  μπορούσαν ναδανείζονται με απόφαση του Συμβουλίου.  Δεν υπήρχε κανένα όριο στα ποσά που μπορούσε να δανειστεί κάποιος Δήμος ή Νομαρχία, ούτε συνδεόταν η λήψη δανείου με προϋποθέσεις  δυνατότητας αποπληρωμής του. Τίθενται προϋποθέσεις και διαδικασίες για τη λήψη δανείου από τις Περιφέρειες: α) το ετήσιο κόστος εξυπηρέτησης της δημόσιας πίστης κάθε Περιφέρειας να μην υπερβαίνει το 5,5% των ετήσιων τακτικών της εσόδων
    β) το συνολικό χρέος της Περιφέρειας που προβαίνει σε δανεισμό να μην υπερβαίνει το ποσοστό των συνολικών εσόδων της. Ως συνολικό χρέος θεωρούνται οι συνολικές μακροπρόθεσμες και βραχυπρόθεσμες υποχρεώσεις της.
    Οι Νομαρχίες  δεν υποχρεούνταν να πραγματοποιούν 4ετή σχεδιασμόοικονομικής πολιτικής Οι Περιφέρειες  καταρτίζουν  πενταετές Επιχειρησιακό Πρόγραμμα στο πρώτο 9μηνο κάθε πενταετίας.
    Δεν υπήρχε συγκεκριμένη διαδικασία κατάρτισης του  ετήσιου προϋπολογισμούτων Νομαρχιών. Η Εκτελεστική Επιτροπή συγκεντρώνει και αξιολογεί τις  προτάσεις των υπηρεσιών της  Περιφέρειας για το Ετήσιο Πρόγραμμα Δράσης και τον προϋπολογισμό και τα εισηγείται στην Οικονομική Επιτροπή, προκειμένου η τελευταία να προβεί στην κατάρτιση αυτών και την υποβολή τους στο Περιφερειακό Συμβούλιο.
    Δεν υπήρχε δυνατότητα πρόσβασης του κάθε πολίτη στηνπληροφόρηση για τα οικονομικά της Νομαρχίας. Συνοπτική οικονομική κατάσταση του προϋπολογισμού, όπως ψηφίσθηκε από το περιφερειακό συμβούλιο, και τριμηνιαία έκθεση πορείας του αναρτάται στην ιστοσελίδα της Περιφέρειας.
    Ο προϋπολογισμός κάθε Νομαρχίας αποστέλλονταν για αξιολόγηση στον Υπουργό Οικονομικών, ο οποίος και μπορούσε να ζητήσει την αναμόρφωσή του και επανυποβολή του στο Υπουργείο Οικονομικών. Ο προϋπολογισμός, το ετήσιο πρόγραμμα δράσης, η εισηγητική έκθεση της οικονομικής επιτροπής  και οι αποφάσεις του περιφερειακού  συμβουλίου που αφορούν την επιβολή  των φόρων, τελών, δικαιωμάτων και εισφορών, υποβάλλονται στον Ελεγκτή Νομιμότητας. Εάν ο Ελεγκτής Νομιμότητας  διαπιστώσει ουσιαστικά ή τυπικά προβλήματα επιστρέφει τον προϋπολογισμό  και καλεί το Περιφερειακό Συμβούλιο  να τον αναμορφώσει κατάλληλα  εντός 30 ημερών
    Δεν υπήρχε κάποια ρύθμιση που να προβλέπει  την παρακολούθηση της εκτέλεσης του προϋπολογισμού. Η Οικονομική Επιτροπή, μετά από εισήγηση του υπευθύνου  των οικονομικών υπηρεσιών της, υποβάλλει στο Περιφερειακό Συμβούλιο τριμηνιαία έκθεση για τα αποτελέσματα εκτέλεσης του προϋπολογισμού.

    4. Αποκέντρωση αρμοδιοτήτων  και μεταφορά πόρων  και προσωπικού

    Τι  ίσχυε μέχρι χθες: Τι  αλλάζει με το νόμο <<Καλλικράτη>>:
    Ο αναπτυξιακός προγραμματισμός ανήκε στην Κρατική Περιφέρεια Το σύνολο των αρμοδιοτήτων, που αφορούν τον αναπτυξιακό περιφερειακό προγραμματισμόμεταφέρεται στην Περιφέρεια.Στην αρμοδιότητα  αυτή εντάσσεται όχι μόνον η κατάρτιση  και εκτέλεση των Περιφερειακών  Επιχειρησιακών Προγραμμάτων, αλλά και  η συμμετοχή στην όλη διαδικασία κατάρτισης και εφαρμογής του  Εθνικού Στρατηγικού Πλαισίου αναφοράς (Ε.Σ.Π.Α.) για την προγραμματική περίοδο 2007-2013.Στον ίδιο τομέα εντάσσονται και αρμοδιότητες που σχετίζονται με τη διαχείριση των υδατικών πόρων.
    Οι Αυτοτελείς Υγειονομικές Περιφέρειες εποπτεύονταν από το Υπ. Υγείας και Κοινωνικής Αλληλεγγύης Οι αρμοδιότητες των  Δημοσίων Υγειονομικών Περιφερειών (Δ.Υ.ΠΕ.) μεταφέρονται στην Περιφέρεια.
    Η επισκευή και η συντήρηση των οδικών δικτύων ανήκε και στην Κρατική Περιφέρεια και στη Νομαρχιακή Αυτοδιοίκηση, με αποτέλεσμα πολλές δυσλειτουργίες Τομέας έργων: απονέμονται αρμοδιότητες στην Περιφέρεια, που αφορούν την κατασκευή, συντήρηση και ανακαίνιση οδών, οι οποίες ασκούντο από την Κρατική Περιφέρεια και τις Νομαρχιακές Αυτοδιοικήσεις. Η αρμοδιότητα αυτή συμπεριλαμβάνει και τις αντίστοιχες μελέτες.
    Ο σχεδιασμός, η μελέτη, η κατασκευή και η  συντήρηση αντιπλημμυρικών, συγκοινωνιακών, κτιριακών κλπ έργων ανήκε και στην Κρατική Περιφέρεια και το Υπουργείο Υποδομών Μεταφορών και Δικτύων με συνέπεια πολλές δυσλειτουργίες Ο σχεδιασμός, η μελέτη, η κατασκευή και συντήρηση συγκοινωνιακών, αντιπλημμυρικών, κτιριακών, ηλεκτρομηχανολογικών και λιμενικών έργων, η εκπόνηση κυκλοφοριακών μελετών, η αντιμετώπιση θεμάτων οδικής κυκλοφορίας, καθώς και η διαχείριση ειδικών έργων περιφερειακού επιπέδου που έχουν εκτελεσθεί από τις Ε.Υ.Δ.Ε.μεταφέρονται στην Περιφέρεια.
    Τα  εγγειοβελτιωτικά έργαανήκαν στο Υπ. Αγροτικής Ανάπτυξης &Τροφίμων Αρμοδιότητες  σχετικές με την εκτέλεση εγγειοβελτιωτικών  έργων (ΓΟΕΒ) μεταφέρονται στην Περιφέρεια.
    Θέματα κατάρτισης, εποπτείας Δημοσίων ΙΕΚ και λειτουργικής υποστήριξής τους ανήκαν στο Υπ. Παιδείας, Δια Βίου Μάθησης και Θρησκευμάτων Θέματα κατάρτισης, εποπτεία Δημοσίων ΙΕΚ και λειτουργική  υποστήριξη μεταφέρονται στην Περιφέρεια.
    Σήμερα 25 Αθλητικά ΚέντραΠεριφερειακού Χαρακτήρα ανήκουν στο Υπουργείο Πολιτισμού και Τουρισμού Το σύνολο των αρμοδιοτήτων για τη λειτουργία και εποπτεία των  Αθλητικών Κέντρων Περιφερειακού  χαρακτήρα μεταφέρονται στην Περιφέρεια.

    Τέλος,στη θέση των σημερινών 13 Διοικητικών Περιφερειών συγκροτούνται έως 7 Γενικές
    Διοικήσεις.
    Στην έδρα κάθε Γενικής Διοίκησης συνιστάται Γενική Διεύθυνση της
    οποίας προΐσταται μόνιμος δημόσιος υπάλληλος. Στις υπηρεσίες της
    Γενικής Διοίκησης εντάσσονται οι υπάλληλοι των υφιστάμενων
    Περιφερειών έκτος από εκείνους που μετατάσσονται στις Περιφερειακές
    Αυτοδιοικήσεις.
    Στις αρμοδιότητες των Γενικών Διοικήσεων :
    • ανήκουν οι γενικές κρατικές υποθέσεις, οι οποίες ασκούνταν μέχρι
    σήμερα από τις Διοικητικές Περιφέρειες και λόγω της φύσης τους ή
    για συνταγματικούς λόγους δεν μπορεί να μεταφερθούν στην
    περιφερειακή αυτοδιοίκηση και παραμένουν στην κρατική διοίκηση,
    π.χ. χωροταξία – πολεοδομία, περιβαλλοντική πολιτική, δασική
    πολιτική ή μεταναστευτική πολιτική,
    • εντάσσονται όσες κρατικές αρμοδιότητες σταδιακά
    αποκεντρώνονται επειδή δεν είναι απαραίτητο να ασκούνται από
    την κεντρική διοίκηση, διευκολύνοντας την αποτελεσματική
    άσκηση του επιτελικού, συντονιστικού και ελεγκτικού της ρόλου,
    • εντάσσονται, όπου αυτό κριθεί σκόπιμο, και κλαδικά
    αποκεντρωμένες κρατικές υπηρεσίες των υπουργείων, που έως
    σήμερα δεν είναι ενταγμένες στις διοικητικές περιφέρειες.

    Δικηγόρος Αθηνών Χρήστος Ηλ. Τσίχλης.

    πηγή: (διαβάστε περισσότερα) http://www.alphafm.gr/archives/6416

     
  • lithari 1:08 am on 22/07/2018 Μόνιμος σύνδεσμος |  

    ΨΑΧΝΟΝΤΑΣ ΣΤΟ ΧΑΟΣ ΚΑΙ ΣΚΑΛΙΖΟΝΤΑΝ ΤΑ ( ασκάλιστα ) ΕΠΕΣΑ ΕΠΑΝΩ ΣΕ ΕΝΑ ΧΑΡΤΙ ( για λογούς δεοντολογίας ο χάρτης σε σχέση με το πρωτότυπο έχει διαφορές ) ΡΩΤΩ ΓΝΩΡΙΖΕΙ ΚΑΠΟΙΟΣ ΣΥΓΧΩΡΙΑΝΟΣ ΜΟΥ ΑΠΟ ΤΟ ΒΑΣΙΛΟΠΟΥΛΟ ( κατά παράδοση ΔΗΜΟΥ ΖΙΤΣΑΣ ) ΤΗ ΑΚΡΙΒΟΣ ΕΙΝΑΙ ΑΥΤΟΣ Ο ΧΑΡΤΗΣ? 

     

    ΨΑΧΝΟΝΤΑΣ ΣΤΟ ΧΑΟΣ  ΚΑΙ ΣΚΑΛΙΖΟΝΤΑΝ ΤΑ ( ασκάλιστα ) ΕΠΕΣΑ ΕΠΑΝΩ ΣΕ ΕΝΑ ΧΑΡΤΙ ( για λογούς δεοντολογίας,   ο χάρτης σε σχέση με το πρωτότυπο έχει διαφορές ) ΡΩΤΩ ΓΝΩΡΙΖΕΙ ΚΑΠΟΙΟΣ  ΣΥΓΧΩΡΙΑΝΟΣ ΜΟΥ ΑΠΟ ΤΟ ΒΑΣΙΛΟΠΟΥΛΟ ( κατά παράδοση ΔΗΜΟΥ ΖΙΤΣΑΣ )  ΤΗ ΑΚΡΙΒΟΣ ΕΙΝΑΙ ΑΥΤΟΣ Ο ΧΑΡΤΗΣ? Φ.ΣΤΥ.Β.

    ΒΑΣΙΛΟΠ

     
  • lithari 7:15 pm on 19/07/2018 Μόνιμος σύνδεσμος |  

    Αναλυτική ανακοίνωση από ΟΠΕΚΕΠΕ σχετικά με τις ενέργειες στις οποίες θα πρέπει να προβούν οι παραγωγοί… Δασικοί Χάρτες: …Εφόσον η έκταση έχει χαρακτηριστεί ΔΑ ή ΧΑ (και δεν είναι ιδιωτικό χορτολίβαδο), τότε μπορεί ο πολίτης ως τις 08/08/2020:… 

    Δασικοί Χάρτες: τί πρέπει να κάνουν οι παραγωγοί

    Δασικοί Χάρτες: τί πρέπει να κάνουν οι παραγωγοί

    Αναλυτική ανακοίνωση από ΟΠΕΚΕΠΕ σχετικά με τις ενέργειες στις οποίες θα πρέπει να προβούν οι παραγωγοί. 

    Σε συνέχεια των παρακάτω ενημερώσεων:

    1) από 09/03/2018 ανακοίνωσης του ΟΠΕΚΕΠΕ με Θέμα: «Ανακοίνωση σχετικά με την ενημέρωση για επικάλυψη αγροτεμαχίων με τους αναρτημένους Δασικούς Χάρτες (Β΄ και Γ΄ φάση ανάρτησης)» (αναρτημένη στο site ΟΠΕΚΕΠΕ) προς τους παραγωγούς.

    2) του από 13/03/2018 μηνύματος ηλεκτρονικής αλληλογραφίας του Προϊσταμένου της Δ/νσης Τεχνικών Ελέγχων του ΟΠΕΚΕΠΕ προς τα ΚΥΔ με θέμα: «Δασικοί Χάρτες – ενημέρωση ΚΥΔ»

    3) του από 14/03/2018 Δελτίου τύπου (είναι αναρτημένο στο site του ΟΠΕΚΕΠΕ) με Θέμα: «Ενημέρωση των παραγωγών σχετικά με ανάρτηση Δασικών Χαρτών»

    4) του από 02/04/2018 μηνύματος ηλεκτρονικής αλληλογραφίας της Δ/νσης Τεχνικών Ελέγχων προς τα ΚΥΔ με θέμα: «ΕΝΗΜΕΡΩΣΗ ΚΥΔ ΓΙΑ ΔΑΣΙΚΟΥΣ ΧΑΡΤΕΣ»

    5) της παλαιότερης από 19/07/2017 ανακοίνωσης του ΟΠΕΚΕΠΕ για τις δηλώσεις του 2017 (είναι αναρτημένη στο site του ΟΠΕΚΕΠΕ)

    συνοψίζουμε παρακάτω στις ενέργειες που πρέπει να προβούν οι παραγωγοί των οποίων οι δηλώσεις τεμαχίων στην ΕΑΕ 2018 εμπλέκονται με Δασικούς χάρτες:

    1)Στην ιστοσελίδα του κτηματολογίου (Τι πρέπει να γνωρίζει ο πολίτης ) αναγράφονται χρήσιμες πληροφορίες για τους πολίτες: http://www.ktimatologio.gr/forestmaps/Pages/das.aspx

    2)Τα διαθέσιμα εργαλεία είναι τα ακόλουθα:

    Α. Εφόσον η έκταση έχει χαρακτηριστεί ΔΑ ή ΧΑ (και δεν είναι ιδιωτικό χορτολίβαδο), τότε μπορεί ο πολίτης ως τις 08/08/2020:

    1. Να υποβάλλει αίτηση ατελώς στο Δασαρχείο της περιοχής:
    είτε για εξαγορά της έκτασης εφόσον η εκχέρσωση έχει γίνει προ του 1975,είτε για χρήση (έγκριση επέμβασης) της έκτασης εφόσον η εκχέρσωση έχει γίνει μέχρι το 2007

    Εάν αιτηθεί την εξαγορά, τότε θα χρειαστεί να υποβάλλει στο Δασαρχείο:

    i. Αίτηση εξαγοράς
    ii. Τοπογραφικό διάγραμμα με συντεταγμένες κορυφών, βασιζόμενες στο Εθνικό Γεωδαιτικό Σύστημα Αναφοράς (ΕΓΣΑ 87)
    iii. Αποδεικτικό χρήσης της έκτασης προ του 1975

    Εάν αιτηθεί την χρήση ( έγκριση επέμβασης), τότε θα χρειαστεί να υποβάλλει στο Δασαρχείο:

    i. Αίτηση χρήσης (έγκριση επέμβασης)
    ii. Τοπογραφικό διάγραμμα με συντεταγμένες κορυφών, βασιζόμενες στο Εθνικό Γεωδαιτικό Σύστημα Αναφοράς (ΕΓΣΑ 87)

    2. Να υποβάλλει αίτηση ατελώς για την υπαγωγή σε προφανές σφάλμα του δασικού χάρτη

    Εάν θεωρεί ότι υπάρχει προφανές σφάλμα στον χάρτη (μπορεί να δει τις κατηγορίες στην Υπουργική Απόφαση 153394/919/12.04.2017 (Β΄ 1366)), όπως για παράδειγμα τον χαρακτηρισμό ως δάσους ανέκαθεν γεωργικής καλλιέργειας, λόγω αδιαμφησβήτητου σφάλματος στη φωτοερμηνεία, τότε μπορεί:

    i. Να υποβάλλει ατελώς αίτηση πρόδηλου σφάλματος μέσω της ειδικής εφαρμογής που υπάρχει στο διαδίκτυο στην ιστοσελίδα της ΕΚΧΑ ΑΕ,http://www.ktimatologio.gr
    ii. Να υποβάλλει ατελώς αίτηση πρόδηλου σφάλματος απευθείας στη Διεύθυνση Δασών της περιοχής.

    3. Να υποβάλλει αντίρρηση επί του χαρακτήρα της έκτασης

    i. Η αντίρρηση υποβάλλεται εφόσον υπάρχει αμφισβήτηση για την φωτοερμηνεία που έχει γίνει στο δασικό χάρτη και τον χαρακτήρα που παρουσιάζεται σε αυτόν.
    ii. Τα τέλη αντίρρησης είναι μειωμένα έως και 80% σε σχέση με το παρελθόν και υπάρχουν στην ΚΥΑ 151585/323/3.2.2017(ΦΕΚ Β? 347/08.02.2017)
    iii. Στην ίδια ΚΥΑ υπάρχουν οι περιπτώσεις που οι αντιρρήσεις υποβάλλονται ατελώς (για παράδειγμα κληροτεμάχια από διανομή τα οποία φαίνονται ως ΔΑ ή ΧΑ στον χάρτη).
    iv. Η αντίρρηση υποβάλλεται μέσω της εφαρμογής της ΕΚΧΑ ΑΕ στην ιστοσελίδα http://www.ktimatologio.gr

    4. Χρήση και των τριών εργαλείων 

    Εφόσον θέλει να χρησιμοποιήσει και τα τρία εργαλεία ή δυο από αυτά μαζί, μπορεί να το κάνει χωρίς περιορισμό ως την οριζόμενη ημερομηνία (https://www.ktimanet.gr/CitizenWebApp/PinakasNewAnartDasika.aspx).

    Σε αυτή την περίπτωση:

    i. Θα εξεταστεί πρώτα η αίτηση πρόδηλου σφάλματος
    ii. Εφόσον απορριφθεί το πρόδηλο σφάλμα, θα εξεταστεί η αντίρρηση από τις ΕΠΕΑ
    iii. Εάν απορριφθεί και η αντίρρηση, τότε θα εξεταστεί το αίτημα εξαγοράς ή έγκρισης επέμβασης.

    Σε όλες τις περιπτώσεις η αίτηση αυτή θα εξαιρέσει την έκταση από την μερική κύρωση του χάρτη,θα διασφαλίσει την επιδότηση και με την ολική κύρωση του χάρτη θα βρίσκεται σε νόμιμη αλλαγή χρήσης και δεν θα υπάρχει κανένα πρόβλημα για τις επιδοτήσεις.

    Β. Εάν η έκταση έχει οποιονδήποτε άλλο χαρακτηρισμό εκτός από ΔΑ ή ΧΑ, δηλαδή είναι ΔΔ, ΑΔ, ΧΧ, ή ΑΧ, τότε μπορεί ως την οριζόμενη ημερομηνία (https://www.ktimanet.gr/CitizenWebApp/PinakasNewAnartDasika.aspx):

    1. Να υποβάλλει αίτηση ατελώς για την υπαγωγή σε προφανές σφάλμα του δασικού χάρτη

    Εάν θεωρεί ότι υπάρχει προφανές σφάλμα στον χάρτη (μπορεί να δει τις κατηγορίες στην Υπουργική Απόφαση 153394/919/12.04.2017 (Β? 1366)), όπως για παράδειγμα τον χαρακτηρισμό ως δάσους ανέκαθεν γεωργικής καλλιέργειας, λόγω αδιαμφησβήτητου σφάλματος στην φωτοερμηνεία, τότε μπορεί:

    i. Να υποβάλλει ατελώς αίτηση πρόδηλου σφάλματος μέσω της ειδικής εφαρμογής που υπάρχει στο διαδίκτυο στην ιστοσελίδα της ΕΚΧΑ ΑΕ,http://www.ktimatologio.gr
    ii. Να υποβάλλει ατελώς αίτηση πρόδηλου σφάλματος απευθείας στη Διεύθυνση Δασών της περιοχής.

    2. Να υποβάλλει αντίρρηση επί του χαρακτήρα της έκτασης 

    i. Η αντίρρηση υποβάλλεται εφόσον υπάρχει αμφισβήτηση για την φωτοερμηνεία που έχει γίνει στο δασικό χάρτη και τον χαρακτήρα που παρουσιάζεται σε αυτόν.
    ii. Τα τέλη αντίρρησης είναι μειωμένα έως και 80% σε σχέση με το παρελθόν και υπάρχουν στην ΚΥΑ 151585/323/3.2.2017(ΦΕΚ Β? 347/08.02.2017)
    iii. Στην ίδια ΚΥΑ υπάρχουν οι περιπτώσεις που οι αντιρρήσεις υποβάλλονται ατελώς (για παράδειγμα κληροτεμάχια από διανομή τα οποία φαίνονται ως ΔΑ ή ΧΑ στον χάρτη).
    iv. Η αντίρρηση υποβάλλεται μέσω της εφαρμογής της ΕΚΧΑ ΑΕ στην ιστοσελίδα http://www.ktimatologio.gr

    3. Χρήση και των δύο εργαλείων

    Εφόσον θέλει να χρησιμοποιήσει και τα δύο εργαλεία, μπορεί να το κάνει χωρίς περιορισμό ως την οριζόμενη ημερομηνία (https://www.ktimanet.gr/CitizenWebApp/PinakasNewAnartDasika.aspx).

    Σε αυτή την περίπτωση:

    i. Θα εξεταστεί πρώτα η αίτηση πρόδηλου σφάλματος
    ii. Εφόσον απορριφθεί το πρόδηλο σφάλμα, θα εξεταστεί η αντίρρηση από τις ΕΠΕΑ

    4. Χρήση άλλων διαθέσιμων εργαλείων της δασικής νομοθεσίας

    Εφόσον τα παραπάνω δύο εργαλεία δεν λύσουν το πρόβλημα, η δασική νομοθεσία περιλαμβάνει εργαλεία τα οποία δίνουν λύσεις.

    Μερικά από αυτά είναι:

    Νομοθεσία περί δασωμένων αγρών (Άρθρο 67,Ν. 998/79)

    Εφόσον έχει τίτλους που ανάγονται προ του 1946 και η έκταση χαρακτηρίζεται ως δασική (όχι δάσος), τότε αυτή μπορεί να τεθεί εκτός δασικής νομοθεσίας.

    Εφόσον οι τίτλοι είναι νεότεροι, αλλά όχι μετά το 2004 και η έκταση χαρακτηρίζεται ως δασική (όχι δάσος), τότε αυτή μπορεί να παραχωρηθεί για γεωργική ή δενδροκομική καλλιέργεια.

    Νομοθεσία περί παραχωρητηρίων.

    Στη νομοθεσία υπάρχει ήδη διαδικασία για την παραχώρηση καστανοτεμαχίων.

    Θα μπορούν όσοι κατέχουν προσωρινά παραχωρητήρια από τη δασική υπηρεσία να τα κάνουν οριστικά μέσα σε τρία χρόνια. Γι αυτές τις περιπτώσεις δεν θα χρειάζεται η υποβολή αντίρρησης.

    Νομοθεσία περί άρσης αναδασώσεων λόγω πραγματικών ή νομικών αιτιών (παρ. 4 άρθρου 44 Νόμου 998/79)
    Αναφέρεται ότι στο Σύστημα Αναγνώρισης Αγροτεμαχίων του ΟΣΔΕ, έτους 2018, οι αναρτημένοι δασικοί χάρτες καθώς και οι κυρωμένοι δασικοί χάρτες έχουν ενσωματωθεί στα νέα θεματικά επίπεδα που είναι:

    Α) ΑΝΑΡΤΗΜΕΝΟΙ ΔΑΣΙΚΟΙ: περιλαμβάνονται οι αναρτημένοι δασικοί χάρτες, για τους κωδικούς των οποίων ισχύει η προαναφερόμενη εργαλειοθήκη που έχει αποσταλεί στα ΚΥΔ και είναι αναρτημένη και στην ιστοσελίδα του ΟΠΕΚΕΠΕ.

    Β) ΚΥΡΩΜΕΝΟΙ ΔΑΣΙΚΟΙ: περιλαμβάνονται οι κυρωμένοι δασικοί χάρτες οι οποίοι θα ληφθούν υπόψη στους Διασταυρωτικούς Ελέγχους. Επισημαίνεται ότι για τους κωδικούς ΔΑ και ΧΑ υπάρχει ακόμα προθεσμία τακτοποίησης (ρύθμισης) μέχρι 08/08/2020. Για τους υπόλοιπους κωδικούς ισχύουν οι διατάξεις της Δασικής Νομοθεσίας

     
  • lithari 7:06 pm on 19/07/2018 Μόνιμος σύνδεσμος |  

    Τεχνικός Κανονισμός για τον καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου…Ποικιλίες αμπέλου:… Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο… 

     

     

    Ποικιλίες αμπέλου: Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο

    Ποικιλίες αμπέλου: Τεχνικός Κανονισμός και εγγραφή στον Εθνικό Κατάλογο

    Δημοσιεύτηκε σε ΦΕΚ ο Τεχνικός Κανονισμός για τον καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου. 

    PHGH

    Σκοπός

    α) Η συμμόρφωση προς την οδηγία 2004/29/ΕΚ της Επιτροπής, της 4ης Μαρτίου 2004, για καθορισμό των χαρακτηριστικών και των ελαχίστων προϋποθέσεων για τον έλεγχο ποικιλιών αμπέλου (ΕΕ L 71, 10.3.2004 σ. 22).

    β) Ο καθορισμός της διαδικασίας εγγραφής των βελτιωμένων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό Κατάλογο ποικιλιών καλλιεργουμένων φυτικών ειδών της παρ. 1 του άρθρου 6 του ν. 1564/1985 (Α’ 164).

    γ) Ο καθορισμός της διαδικασίας εγγραφής των εγχώριων αβελτίωτων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό Κατάλογο.

    Δείτε αναλυτικά ολόκληρο τον Τεχνικό Κανονισμό και τους σχετικούς πίνακες ΕΔΩ.

    ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΒΛΑΣΤΙΚΑ ΣΤΑΔΙΑ

    1.1. Ημερομηνίες εμφανίσεως βλαστικών σταδίων Οι ημερομηνίες εμφανίσεως των βλαστικών σταδίων ορίζονται κατόπιν συγκρίσεως με μία ή περισσότερες από τις ακόλουθες ποικιλίες μάρτυρες. 
    1.1.1. ποικιλίες λευκών σταφυλιών – Σαββατιανό (Savatiano), Ζουμιάτικο (Zoumiatiko), Βηλάνα (Vilana), Ασύρτικο (Assyrtiko), Chardonnay.

    1.1.2. ποικιλίες μαύρων σταφυλιών – Μανδηλαριά (Mandilaria), Ξυνόμαυρο (Xynomavro), Cabernet Sauvignon, Κορινθιακή (Korinthiaki).

    1.1.3. ποικιλίες επιτραπέζιων σταφυλιών – Ραζακί (Razaki), Cardinal, Iτάλια (Italia), Σουλτανίνα (Soultanina), Perlette.

    1.2. Ημερομηνία εκπτύξεως Ημερομηνία κατά την οποία εκπτύσσεται πλήρως το ήμισυ των οφθαλμών ενός πρέμνου κανονικά κλαδευμένου και φαίνεται ο εσωτερικός τους χνοασμός σε σχέση με τις ποικιλίες μάρτυρες.

    1.3. Ημερομηνία πλήρους ανθήσεως Ημερομηνία κατά την οποία, για ένα σύνολο φυτών, το ήμισυ των ανθέων είναι ανοικτά συγκρινόμενο με τις ποικιλίες μάρτυρες.

    1.4. Ωριμότης (όσον αφορά τις οινοποιήσιμες ποικιλίες και τις επιτραπέζιες ποικιλίες). Επιπροσθέτως της περιόδου ωριμότητος εξετάζονται η πυκνότης ή ο πιθανός βαθμός του γλεύκους, η οξύτης του και η αντίστοιχη απόδοση σεσταφυλές εκφραζομένη σε χιλιόγραμμα ανά αντίστοιχο εκτάριο σε σύγκριση με μιά ή περισσότερες ποικιλίες μάρτυρες που έχουν δώσει κατά το δυνατό αποδόσεις της αυτής τάξεως μεγέθους.

    1.5. Ημερομηνία φυλλόπτωσης

    2. ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΚΑΛΛΙΕΡΓΕΙΑΣ

    2.1. Ζωηρότης: παρατήρηση κατά την άνθηση και μετά την φυλλόπτωση. Οπτική εκτίμηση του μήκους και της διαμέτρου των κύριων βλαστών. Μέση τιμή 10 βλαστών κοντά στον κορμό. (Κωδικός OIV 351).

    2.2. Τρόπος μορφώσεως (θέση του πρώτου καρποφόρου οφθαλμού, προτιμώμενο κλάδεμα): (Κωδικός OIV 155).

    2.3. Παραγωγή 2.3.1. κανονικότης.

    2.3.2. απόδοση:

    Α) Ποικιλίες: Μετράται η απόδοση της ποικιλίας (κιλά/ στρ.) σε σύγκριση με μια ή περισσότερες ποικιλίες μάρτυρες. (Κωδικός OIV 504). Β) Υποκείμενα: Μετράται η απόδοση σε μοσχεύματα ανά στρέμμα (Κωδικός OIV 551).

    2.3.3. ανωμαλίες: Μικροραγία (Κωδικός OIV 222), ανθόροια (ποσοστό καρπόδεσης, Κωδικός OIV 501), ανισοραγία (Κωδικός OIV 222).

    2.4. Ανθεκτικότης ή ευαισθησία (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.4.1. σε δυσμενείς συνθήκες: χλώρωση από έλλειψη σιδήρου (OIV 401), αλατότητα (OIV 402), ξηρασία (OIV 403).

    2.4.2. σε επιβλαβείς οργανισμούς: περονόσπορος (OIV 452-1), ωίδιο (OIV 455-1), βοτρύτις (OIV 458-1), ευτυπίωση (OIV 460), φυλλόβιος φυλλοξήρα (OIV 461), ριζόβιος φυλλοξήρα (OIV 462).

    2.4.3. πιθανή ευαισθησία στη σχάση των ραγών.

    2.5. Συμπεριφορά κατά τον αγενή πολλαπλασιασμό (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.5.1. εμβολιασμός (OIV 552).

    2.5.2. πολλαπλασιασμός με μοσχεύματα (OIV 553)
     

    PHGH

    ========================================================

    ΤΗΣ ΚΥΒΕΡΝΗΣΕΩΣ

    ΤΗΣ ΕΛΛΗΝΙΚΗΣ ∆ΗΜΟΚΡΑΤΙΑΣ

    16 Ιουλίου 2018                                ΤΕΥΧΟΣ  ΔΕΥΤΕΡΟ                               Αρ. Φύλλου 2816

    ΑΠΟΦΑΣΕΙΣ

    Αριθμ. 1649/89081

    Τεχνικός Κανονισμός για τον καθορισμό των χα-

    ρακτηριστικών και των ελαχίστων προϋποθέσε-

    ων για τον έλεγχο ποικιλιών αμπέλου (Vitis L.) σε

    συμμόρφωση προς την Οδηγία 2004/29/ΕΚ, (ΕΕ L

    71, 10.03.2004, σ. 22) και άλλες εθνικές διατάξεις.

    Ο ΥΦΥΠΟΥΡΓΟΣ

    ΑΓΡΟΤΙΚΗΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΤΡΟΦΙΜΩΝ

    Έχοντας υπόψη:

    1. Τις διατάξεις:

    α) των άρθρων 6 παρ. 3 και 3α, 10 παρ. 3, 14 παρ. 3

    και 27 παρ. 3 του ν. 1564/1985 «Οργάνωση παραγωγής

    και εμπορίας του πολλαπλασιαστικού υλικού φυτικών ει-

    δών» (Α’ 164), όπως η παρ. 3α του άρθρου 6 προστέθηκε

    με την παρ. 1 του άρθρου 16 του ν. 4351/2015 (Α’ 164).

    β) του άρθρου 62 παρ. 2 περ. α’ του ν. 4235/2014 «Διοι-

    κητικά μέτρα, διαδικασίες και κυρώσεις στην εφαρμογή

    της ενωσιακής και εθνικής νομοθεσίας στους τομείς των

    τροφίμων, των ζωοτροφών και της υγείας και προστα-

    σίας των ζώων και άλλες διατάξεις αρμοδιότητας του

    Υπουργείου Αγροτικής Ανάπτυξης και Τροφίμων» (Α’32),

    όπως η παρ. 2 τροποποιήθηκε με την παρ. 2 του άρθρου

    46 του ν. 4384/2016 «Αγροτικοί Συνεταιρισμοί, μορφές

    συλλογικής οργάνωσης του αγροτικού χώρου και άλλες

    διατάξεις» (Α’78).

    γ) του άρθρου 90 του Κώδικα νομοθεσίας για την Κυ-
    βέρνηση και τα κυβερνητικά Όργανα, όπως κυρώθηκε

    με το άρθρο πρώτο του π.δ. 63/2005 «Κωδικοποίηση

    της νομοθεσίας για την Κυβέρνηση και τα κυβερνητικά όργανα» (Α’ 98).

    1. Την αριθμ. 11226/133908/30.11.2016 απόφαση του

    Πρωθυπουργού και του Υπουργού Αγροτικής Ανάπτυ-

    ξης και Τροφίμων «Ανάθεση αρμοδιοτήτων στον Υφυ-

    πουργό Αγροτικής Ανάπτυξης και Τροφίμων Βασίλειο

    Κόκκαλη» (Β’ 3903), όπως τροποποιήθηκε με την αριθμ. 638/128269/30.11.2017 (Β’ 4250) όμοια απόφαση.

    1. Την γνώμη της Τεχνικής Επιτροπής Πολλαπλασια-

    στικού Υλικού (Τ.Ε.Π.Υ.) του άρθρου 20 του ν. 1564/1985

    (Α’ 164), όπως έχει τροποποιηθεί και ισχύει, όπως αυτή δι-

    ατυπώνεται στα από 6.3.2018 πρακτικά συνεδρίασής της.

    1. Το γεγονός ότι από τις διατάξεις της απόφασης

    αυτής δεν προκαλείται δαπάνη σε βάρος του Κρατικού προϋπολογισμού, αποφασίζουμε:

    Σκοπός της απόφασης αυτής είναι:

    Άρθρο 1

    Σκοπός

    α) Η συμμόρφωση προς την οδηγία 2004/29/ΕΚ της

    Επιτροπής, της 4ης Μαρτίου 2004, για καθορισμό των

    χαρακτηριστικών και των ελαχίστων προϋποθέσεων για

    τον έλεγχο ποικιλιών αμπέλου (ΕΕ L 71, 10.3.2004 σ. 22).
       β) Ο καθορισμός της διαδικασίας εγγραφής των βελ-

    τιωμένων ποικιλιών αμπέλου (Vitis L.) στον Εθνικό κα-

    τάλογο ποικιλιών καλλιεργουμένων φυτικών ειδών της παρ. 1 του άρθρου 6 του ν. 1564/1985 (Α’ 164) (στο εξής Εθνικός Κατάλογος).

    γ) Ο καθορισμός της διαδικασίας εγγραφής των εγ-

    χώριων αβελτίωτων ποικιλιών αμπέλου (Vitis L.) στον

    Εθνικό Κατάλογο.

    Άρθρο 2

    Επίσημοι έλεγχοι

    (άρθρο 1 της οδηγίας 2004/29/ΕΚ)

    1. Οι επίσημοι έλεγχοι που διεξάγονται για την αποδο-

    χή των ποικιλιών αμπέλου της παρούσας απόφασης είναι

    Δοκιμές Διακριτότητας – Ομοιομορφίας – Σταθερότητας

    (Δοκιμές Δ.Ο.Σ.) και διενεργούνται από το Τμήμα Ελέγχου

    Ποικιλιών Καλλιεργουμένων Φυτών (Τ.Ε.Π.Κ.Φ.) της Διεύ-

    θυνσης Πολλαπλασιαστικού Υλικού Καλλιεργούμενων

    Φυτικών Ειδών και Φυτογενετικών Πόρων του Υπουρ-

    γείου Αγροτικής Ανάπτυξης και Τροφίμων. Σε ό,τι αφο-
    ρά την ομοιομορφία, η ποικιλία θεωρείται ομοιόμορφη

    όταν ο αριθμός των αποκλινόντων φυτών δεν υπερβαίνει

    το 1% των εξεταζόμενων φυτών (ομοιομορφία 99,0% με

    πιθανότητα 95%, δηλαδή 0 αποκλίνοντα φυτά σε σύνολο

    5 εξεταζόμενων πρέμνων ή 1 αποκλίνον φυτό σε σύνολο

    24 εξεταζόμενων πρέμνων).

    1. Οι δοκιμές της παρ. 1 διαρκούν τρία (3) συνεχόμενα

    έτη. Οι ποικιλίες αμπέλου προτείνονται για εγγραφή στον

    Εθνικό Κατάλογο Ποικιλιών Καλλιεργούμενων Φυτικών
    Ειδών εφόσον πληρούνται τα κριτήρια των δοκιμών για

    την Διακριτότητα, την Ομοιομορφία και την Σταθερό-

    τητα του μέρους Α και εφόσον δεν επαρκούν και του

    μέρους Β του παραρτήματος I του άρθρου 5.

    36040                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    1. Τα ελάχιστα χαρακτηριστικά του φυτού των υπο-

    ψήφιων για εγγραφή ποικιλιών της αμπέλου που εξε-

    τάζονται στις δοκιμές Δ.Ο.Σ. αναφέρονται στα μέρη Α

    και Γ του παραρτήματος I του άρθρου 5. Τα πρόσθετα

    χαρακτηριστικά που εξετάζονται στις δοκιμές Δ.Ο.Σ.

    αναφέρονται στα μέρη Β και Δ του ίδιου παραρτήματος.

    1. Οι ελάχιστες προϋποθέσεις για την πραγματοποίηση

    των επίσημων ελέγχων αναφέρονται στο παράρτημα II του άρθρου 5.

    Άρθρο 3

    Διαδικασία εγγραφής

    βελτιωμένων ποικιλιών αμπέλου

    1. Για να καταχωριστεί μια ποικιλία αμπέλου της περ. β’ του άρθρου 1 στον Εθνικό Κατάλογο,

    α) ο δημιουργός της ποικιλίας ή ο διατηρητής της ποι-

    κιλίας ή ο νόμιμος εκπρόσωπος του δημιουργού που

    έχει την έδρα του ή την κατοικία του στην Ε.Ε. και έχει

    ορισθεί με εξουσιοδότηση του δημιουργού ή του δια-

    τηρητή, υποβάλλει στο Τ.Ε.Π.Κ.Φ. ειδική έντυπη αίτηση
    που χορηγείται από το Τ.Ε.Π.Κ.Φ. συνοδευόμενη από:

    αα) πληροφοριακά στοιχεία σε ειδικό έντυπο που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ., τα οποία δίνουν την κατά το δυνατόν πληρέστερη περιγραφή της ποικιλίας και των αγρονομικών συνθηκών κάτω από τις οποίες πρέπει να γίνει η επίσημη εξέταση της ποικιλίας.

    ββ) αντίγραφο πιστοποιητικού φυτικής δημιουργίας

    ή αντίγραφο κοινοτικού δικαιώματος επί φυτικής ποικι-
    λίας, εφόσον υπάρχει.

    γγ) δήλωση του δημιουργού ότι είναι δημιουργός της ποικιλίας.

    δδ) βεβαίωση του δημιουργού ότι η ποικιλία δεν είναι/

    είναι γενετικά τροποποιημένη.

    εε) εξουσιοδότηση του δημιουργού για τον ορισμό

    διατηρητή.

    στστ) δήλωση του διατηρητή ότι διατηρεί την ποικιλία

    και τη χώρα διατήρησης.

    ζζ) αποδεικτικά πληρωμής των προβλεπόμενων για

    την άμπελο τελών δοκιμής, όπως αυτά αναφέρονται

    στην αριθμ. 6321/44913/30.4.2015 απόφαση του Ανα-

    πληρωτή Υπουργού Παραγωγικής Ανασυγκρότησης,

    Περιβάλλοντος και Ενέργειας «Καθορισμός τελών δο-

    κιμής παραβόλων για την υποβολή αίτησης εγγραφής

    ποικιλιών καλλιεργούμενων φυτικών ειδών στον Εθνικό

    Κατάλογο» (Β’ 1099).

    β) διενεργούνται οι επίσημοι έλεγχοι του άρθρου 2

    για να διαπιστωθεί ότι η ποικιλία αμπέλου πληροί τις

    απαιτήσεις της παρ. 1 του άρθρου 6 της αριθμ. 258676/

    29.9.2003 απόφασης (Β’ 1517).

    1. Κατά παρέκκλιση της περ. β’ της παρ. 1, δεν διε-

    νεργούνται οι επίσημοι έλεγχοι του άρθρου 2 εφόσον

    υπάρχει πιστοποιητικό φυτικής δημιουργίας του άρθρου

    8 του ν. 1564/1985 ή κοινοτικό δικαίωμα επί φυτικής

    ποικιλίας αμπέλου, σύμφωνα με τον Κανονισμό (ΕΚ) αριθ.

    2100/94 (ΕΕ L 227, 1.9.1994, σ.1). Στην περίπτωση αυτή,

    η αίτηση της περ. α’ της παρ. 1 υποβάλλεται από τον

    κάτοχο του πιστοποιητικού φυτικής δημιουργίας ή του

    κοινοτικού δικαιώματος επί φυτικής ποικιλίας ή από τον

    εξουσιοδοτημένο εκπρόσωπό του, μαζί με την επίσημη

    περιγραφή της ποικιλίας συμπεριλαμβανομένων και των

    χαρακτηριστικών που αναφέρονται στο παράρτημα I του

    άρθρου 5, τα οποία τυχόν δεν περιλαμβάνονται στην

    επίσημη περιγραφή και όλα τα σχετικά έγγραφα χορή-

    γησης του πιστοποιητικού φυτικής δημιουργίας ή του

    κοινοτικού δικαιώματος επί φυτικής ποικιλίας. Το τέλος

    που καταβάλλεται στην περίπτωση αυτή, ορίζεται στο

    15% του τέλους δοκιμής που καταβάλλεται κατά έτος

    ή καλλιεργητική περίοδο για την άμπελο, σύμφωνα με

    την αριθμ. 6321/44913/30.4.2015 απόφαση. Το ανωτέρω

    τέλος καταβάλλεται μία φορά.

    1. Η αίτηση της περ. α’ της παρ. 1 παραλαμβάνεται σε

    ημερομηνίες καθορισμένες από το Τ.Ε.Π.Κ.Φ., καταχωρί-

    ζεται σε ειδικό μητρώο ποικιλιών και τηρείται φάκελος

    με τον αριθμό μητρώου της ποικιλίας, ο οποίος περι-

    λαμβάνει τη σχετική αλληλογραφία, τα δεδομένα των

    πειραμάτων των δοκιμών Δ.Ο.Σ. και όλα τα στοιχεία για την υποψήφια για εγγραφή ποικιλία.

    1. Για τη συνέχιση των δοκιμών Δ.Ο.Σ. για το δεύτερο

    έτος απαιτείται η υποβολή ειδικής έντυπης αίτησης που

    χορηγείται από το Τ.Ε.Π.Κ.Φ., δήλωση του τελικού ονό-

    ματος της ποικιλίας και αποδεικτικά πληρωμής των προ-

    βλεπόμενων για την άμπελο τελών δοκιμής της αριθμ. 6321/44913/30.4.2015 απόφασης.

    1. Για τη συνέχιση των δοκιμών Δ.Ο.Σ. για τρίτο έτος

    απαιτείται η υποβολή ειδικής έντυπης αίτησης που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ και τα αποδεικτικά πληρωμής των προβλεπόμενων για την άμπελο τελών δοκιμής της αριθμ. 6321/44913/30.4.2015 απόφασης.

    1. Ο αιτών παραδίδει στο Τ.Ε.Π.Κ.Φ. πολλαπλασιαστικό

    υλικό της υποψήφιας για εγγραφή ποικιλίας αμπέλου σε

    ημερομηνίες, ποσότητες και συσκευασίες που καθορί-
    ζονται από το Τ.Ε.Π.Κ.Φ. Το πολλαπλασιαστικό υλικό της

    υποψήφιας για εγγραφή ποικιλίας αμπέλου καλύπτει τις

    φυτοϋγειονομικές απαιτήσεις της χώρας, σύμφωνα με

    τις διατάξεις της αριθμ. 258676/29.9.2003 απόφασης και

    του π.δ. 365/2002 (Α’307), όπως έχουν τροποποιηθεί και

    ισχύουν. Εάν το πολλαπλασιαστικό υλικό της υποψήφιας

    για εγγραφή ποικιλίας αμπέλου χαθεί ή αλλοιωθεί κατά

    την μεταφορά ή την πορεία των δοκιμών ή βρεθεί ότι

    δεν πληροί τις ισχύουσες φυτοϋγειονομικές απαιτήσεις

    της χώρας και είναι ακατάλληλο, το Τ.Ε.Π.Κ.Φ. δύναται

    να ζητήσει νέες ποσότητες πολλαπλασιαστικού υλικού.
       7. Μετά το τέλος των δοκιμών, το Τ.Ε.Π.Κ.Φ. συντάσσει

    σχετική έκθεση και εισηγείται στην Τεχνική Επιτροπή

    Πολλαπλασιαστικού Υλικού (στο εξής Τ.Ε.Π.Υ.) του άρ-

    θρου 20 του ν. 1564/1985 (Α’ 164), η οποία γνωμοδοτεί
    προς τον Υπουργό Αγροτικής Ανάπτυξης και Τροφίμων

    την αποδοχή ή την απόρριψη της ποικιλίας. Η εγγραφή ή

    η απόρριψη της εγγραφής στον Εθνικό Κατάλογο γίνεται

    σύμφωνα με την παρ. 2 του άρθρου 6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι βελτιωμένες ποικιλίες αμπέλου εγγράφονται στον

    Εθνικό Κατάλογο χωρίς να υπόκεινται σε περιορισμούς
    σχετικά με τη διάρκεια της αποδοχής τους και κατά συ-
    νέπεια χωρίς να απαιτείται η ανανέωση εγγραφής τους
    σε αυτόν.

    1. Οποιαδήποτε αλλαγή στην ονομασία ή στην δια-

    τήρηση ποικιλίας αμπέλου εγγεγραμμένης στον Εθνικό

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36041

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι ποικιλίες αμπέλου διαγράφονται από τον Εθνι-

      κό Κατάλογο σύμφωνα με την παρ. 2 του άρθρου 6 του

    ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει, εάν:

    α) αποδειχθεί ότι τα στοιχεία της περ. α’ της παρ. 1 δεν

    είναι αληθή, ή

    β) αποδειχθεί ότι δεν πληρούνται οι προϋποθέσεις και

    οι υποχρεώσεις της διατήρησης σύμφωνα με το άρθρο 9

    της αριθμ. 258676/29.9.2003 απόφασης, μετά από έλεγ-

    χο του Τ.Ε.Π.Κ.Φ., ή

    γ) υποβληθεί σχετική αίτηση από τον διατηρητή της ποικιλίας.

    Στις περ. β’ και γ’, η ποικιλία δεν διαγράφεται, εάν εξα-
    σφαλισθεί η διατήρησή της.

    Άρθρο 4

    Διαδικασία εγγραφής εγχώριων
    αβελτίωτων ποικιλιών αμπέλου

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου της περ.

      γ’ του άρθρου 1, γίνονται αποδεκτές για εγγραφή στον

    Εθνικό Κατάλογο εφόσον πληρούν τις προϋποθέσεις

    της παρ. 1 του άρθρου 6 της αριθμ. 258676/29-09-2003 απόφασης.

    1. Για την καταχώριση μιας εγχώριας αβελτίωτης ποι-

      κιλίας αμπέλου στον Εθνικό Κατάλογο, δεν απαιτείται η

    διενέργεια των επίσημων ελέγχων του άρθρου 2, εφόσον

    πληρούνται οι εξής προϋποθέσεις:

    α) έχει υποβληθεί από τον διατηρητή της παρ. 3 προς

    το Τ.Ε.Π.Κ.Φ. ειδική έντυπη αίτηση που χορηγείται από

    το Τ.Ε.Π.Κ.Φ, συνοδευόμενη από:

    αα) πληροφοριακά στοιχεία σε ειδικό έντυπο που χο-
    ρηγείται από το Τ.Ε.Π.Κ.Φ., τα οποία δίνουν την κατά το

    δυνατόν πληρέστερη περιγραφή της ποικιλίας, σύμφωνα

    με τα χαρακτηριστικά που αναφέρονται στο παράρτημα

    I του άρθρου 5.

    ββ) πληροφορίες που αφορούν σε ιστορικά στοιχεία

    για την περιοχή καλλιέργειας, την ονομασία και την

    καλλιέργεια της ποικιλίας (έκταση, απόδοση, ποιοτικά

    χαρακτηριστικά).

    γγ) πληροφορίες που αφορούν τις αγρονομικές συνθή-

    κες κάτω από τις οποίες έχει διαμορφωθεί και σταθερο-

    ποιηθεί η υποψήφια για εγγραφή ποικιλία αμπέλου στον

    χώρο και τον χρόνο χωρίς την επέμβαση της γενετικής επιστήμης.

    Η αίτηση καταχωρίζεται σε ειδικό μητρώο ποικιλιών

    και τηρείται φάκελος με τον αριθμό μητρώου της ποι-

    κιλίας που περιλαμβάνει την σχετική αλληλογραφία και

    όλα τα στοιχεία για την υποψήφια για εγγραφή ποικιλία.

    Η υποβολή της αίτησης γίνεται σε καθορισμένες από το Τ.Ε.Π.Κ.Φ. ημερομηνίες.

    β) Μετά την υποβολή της αίτησης και των δικαιολογη-

    τικών, το Τ.Ε.Π.Κ.Φ. συντάσσει σχετική έκθεση και ειση-

    γείται στην Τ.Ε.Π.Υ., η οποία γνωμοδοτεί για την αποδοχή

    της ποικιλίας, εφόσον τα στοιχεία της περ. α’ είναι επαρ-

    κή. Η εγγραφή των αβελτίωτων ποικιλιών αμπέλου στον

    Εθνικό Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρ-

    θρου 6 του ν. 1564/1985, όπως έχει τροποποιηθεί και

    ισχύει. Εάν μετά την υποβολή της αίτησης διαπιστωθεί
    ότι τα υποβληθέντα στοιχεία των υποπερ. ββ’ και γγ’ της

    περ. α’ δεν είναι αληθή ή δεν είναι επαρκή, το Τ.Ε.Π.Κ.Φ.

    συντάσσει σχετική έκθεση και εισηγείται στην Τ.Ε.Π.Υ.,

    η οποία γνωμοδοτεί για την απόρριψη της ποικιλίας.

    Η απόρριψη της εγγραφής της ποικιλίας στον Εθνικό

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    γ) Εάν τα υποβληθέντα στοιχεία της υποπερ. αα’ της

    περ. α’ δεν είναι επαρκή για την αποδοχή της εγχώριας

    αβελτίωτης ποικιλίας αμπέλου, το Τ.Ε.Π.Κ.Φ. γνωστοποιεί

    εγγράφως στον αιτούντα την αναγκαιότητα διενέργειας

    των επίσημων ελέγχων του άρθρου 2. Σε αυτήν την περί-

    πτωση, η διάρκεια των δοκιμών Δ.Ο.Σ. ορίζεται σε ένα (1)

    έτος, αυτές πραγματοποιούνται στις εγκαταστάσεις του

    διατηρητή ή υπό την ευθύνη του διατηρητή, ο οποίος

    παρέχει κάθε διευκόλυνση στο Τ.Ε.Π.Κ.Φ και εφαρμόζο-

    νται οι διατάξεις των παρ. 6 και 7 του άρθρου 3. Το τέλος

    που καταβάλλεται στην περίπτωση αυτή, ορίζεται στο

    50% του τέλους δοκιμής που καταβάλλεται κατά έτος ή

    καλλιεργητική περίοδο για την άμπελο, σύμφωνα με την

    αριθμ. 6321/44913/30-04-2015 απόφαση και ανεξάρ-

    τητα από τη διάρκεια των δοκιμών. Το ανωτέρω τέλος

    καταβάλλεται μία φορά.

    1. Ως διατηρητής εγχώριων αβελτίωτων ποικιλιών

      αμπέλου ορίζεται το Iνστιτούτο Ελιάς, Υποτροπικών

    Φυτών και Αμπέλου και το Iνστιτούτο Γενετικής Βελτί-

    ωσης και Φυτογενετικών Πόρων του ΕΛ.Γ.Ο.-ΔΗΜΗΤΡΑ.
    Ο διατηρητής των εν λόγω ποικιλιών αμπέλου συλλέγει

    υλικό των ποικιλιών αυτών και το εγκαθιστά στη συλλογή

    ποικιλιών αμπέλου που διατηρεί.

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου εγγρά-

    φονται στον Εθνικό Κατάλογο χωρίς να υπόκεινται σε

    περιορισμούς σχετικά με τη διάρκεια της αποδοχής τους

    και κατά συνέπεια χωρίς να απαιτείται η ανανέωση εγ-
    γραφής τους σε αυτόν.

    1. Οποιαδήποτε αλλαγή στην ονομασία ή στην δια-

    τήρηση ποικιλίας αμπέλου εγγεγραμμένης στον Εθνικό

    Κατάλογο γίνεται σύμφωνα με την παρ. 2 του άρθρου

    6 του ν. 1564/1985, όπως έχει τροποποιηθεί και ισχύει.

    1. Οι εγχώριες αβελτίωτες ποικιλίες αμπέλου δια-

      γράφονται από τον Εθνικό Κατάλογο με απόφαση

    του Υπουργού Αγροτικής Ανάπτυξης και Τροφίμων, η

    οποία δημοσιεύεται στην Εφημερίδα της Κυβερνήσεως,

    μετά από γνώμη της Τ.Ε.Π.Υ. και κατόπιν εισήγησης του Τ.Ε.Π.Κ.Φ., εάν:

    α) αποδειχθεί ότι τα στοιχεία της περ. α’ της παρ. 2 δεν

    είναι αληθή, ή

    β) αποδειχθεί ότι δεν πληρούνται οι προϋποθέσεις και

    οι υποχρεώσεις της διατήρησης σύμφωνα με το άρθρο 9

    της αριθμ. 258676/29.9.2003 απόφασης, μετά από έλεγ-

    χο του Τ.Ε.Π.Κ.Φ., ή

    γ) υποβληθεί σχετική αίτηση από τον διατηρητή της ποικιλίας.

    Στις περ. β’ και γ’, η ποικιλία δεν διαγράφεται, εάν εξα-
    σφαλισθεί η διατήρησή της.

    Άρθρο 5

    Παραρτήματα

    Προσαρτώνται στην παρούσα απόφαση τα Παραρτή-

    ματα I και II, τα οποία αποτελούν αναπόσπαστο μέρος

    της και έχουν ως εξής:

    36042                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    ΠΑΡΑΡΤΗΜΑ Ι

    (Παράρτημα Ι της Οδηγίας 2004/29/ΕΚ και εθνικές διατάξεις)

    ΜΕΡΟΣ Α

    (ΜΕΡΟΣ Α του Παραρτήματος Ι της Οδηγίας 2004/29/ΕΚ) ΜΟΡΦΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΣΧΗΜΑΤΙΣΜΟΣ ΟΦΘΑΛΜΩΝ (ΕΚΒΛΑΣΤΗΜΑ) ΕΠΙ ΑΝΑΠΤΥΣΣΟΜΕΝΗΣ ΚΛΗΜΑΤΙΔΑΣ ΜΗΚΟΥΣ 10 ΕΩΣ 20 cm

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    1.1.

    σχήμα (άνοιγμα κορυφής):

    1= κλειστή, 2= ελαφρώς ανοιχτή,

    3= μισάνοιχτη, 4= ευρέως ανοιχτή,

    5= πλήρως ανοιχτή

    2

    001

    1.2.

    χρώμα (κατά την έκπτυξη για να

    καταστεί δυνατή η παρατήρηση

    των ανθοκυανών):

    1= πράσινο, 2= άσπρο, 3= κίτρινο,

    4= χαλκόχρουν, 6= χρώμα ορειχάλκου,

    7= υπόξανθο ή ξανθοκόκκινο, 8= ρόδινο,

    9= άλλο χρώμα να περιγραφεί.

    1.3.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΠΟΩΔΗΣ ΚΛΗΜΑΤΙΔΑ ΚΑΤΑ ΤΗΝ ΕΠΟΧΗ ΤΗΣ ΑΝΘΗΣΗΣ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    2.1.

    εγκαρσία διατομή

    (σχήμα και περίγραμμα):

    2=πεπλατυσμένο, 4= ελλειπτικό,

    6= κυκλικό, 8= άλλου τύπου

    να περιγραφεί.

    2.2.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΞΥΛΩΔΗΣ ΚΛΗΜΑΤΙΔΑ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    3.1.

    επιφάνεια:

    2= κυκλική, 4= γωνιώδης, 6= οδοντωτή,

    8= αστεροειδής.

    3.2.

    μεσογονάτιο μήκος

    (8ο – 12ο):

    1= πολύ κοντό, 3= κοντό, 5= μέτριο,

    7= μακρύ, 9= πολύ μακρύ

    353

    4.ΚΑΤΑΝΟΜΗ ΤΩΝ ΕΛΙΚΩΝ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    Κατανομή ελίκων

    1= διαλείπουσα, 5= ασυνεχής,

    9= συνεχής.

    1. ΝΕΑΡΑ ΦΥΛΛΑ ΣΤΗΝ ΚΟΡΥΦΗ ΑΝΑΠΤΥΣΣΟΜΕΝΗΣ ΚΛΗΜΑΤΙΔΟΣ ΜΗΚΟΥΣ 10 ΕΩΣ 30 cm (ΤΡΙΑ ΠΡΩΤΑ

    ΦΥΛΛΑ ΣΕ ΑΠΟΣΤΑΣΗ ΑΠΟ ΤΟ ΣΧΗΜΑΤΙΣΜΟ ΟΦΘΑΛΜΩΝ (ΕΚΒΛΑΣΤΗΜΑ), ΜΕΤΡΟΥΜΕΝΑ ΑΠΟ ΑΥΤΟ ΤΟ ΣΗΜΕΙΟ)

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    5.1.

    χρώμα:

    1= κιτρινοπράσινο, 2= πράσινο,

    3= πράσινο με κηλίδες ανθοκυάνης,

    4= ανοιχτό ερυθρό χαλκόχρουν,

    5= σκούρο ερυθρό χαλκόχρουν,

    6= κρασο-κόκκινο

    6

    051

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36043

    5.2.

    χνοασμός:

    1= απουσία, 2= μεταξώδης,

    4= βελουδοειδής, 6= αραχνοειδής,

    8= χνοώδης, 9= βαμβακώδης.

    1. ΠΛΗΡΩΣ ΑΝΑΠΤΥΓΜΕΝΟ ΦΥΛΛΟ (ΚΕΙΜΕΝΟ ΜΕΤΑΞΥ ΤΟΥ 8ου ΚΑΙ ΤΟΥ 11ου ΓΟΝΑΤΟΥ (ΚΟΜΒΟΥ))

    6.1.     φωτογραφία.

    6.2.     σχεδίασμα ή απ’ ευθείας εκτύπωση σε κλίμακα.

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    6.3.

    γενικό σχήμα:

    1= καρδιόσχημο, 2= σφηνοειδές,

    3= πενταγωνικό, 4= κυκλικό, 5= νεφροειδές

    18

    067

    6.4.

    αριθμός λοβών φύλλου:

    1= ένας, 2= τρεις, 3= πέντε, 4= επτά,

    5= πλέον των επτά

    20

    068

    6.5.

    μισχικός κόλπος:

    1=πολύ ανοικτός, 3= ανοικτός, 5= κλειστός,

    7= επικαλυπτόμενος, 9= πολύ επικαλυπτό-

    μενος

    618

    6.6.

    βάθος του ανώτερου και του κα-

    τώτερου πλευρικού κόλπου:

    1= αβαθές, 3= ελαφρά βαθύ, 5= μέτριο,

    7= βαθύ, 9= πολύ βαθύ.

    6.7.

    χνοασμός της κάτω επιφάνειας:

    1= απουσία, 2= μεταξώδης, 4= βελουδοειδής,

    6= αραχνοειδής, 8= χνοώδης,

    9= βαμβακώδης.

    6.8.

    επιφάνεια:

    1= επίπεδη, 2= κυματοειδής, 4= πομφολυ-

    γώδης, 6= μελικηρώδης, 8= πτυχωτή,

    9= άλλου τύπου.

    6.9.

    πλευρική οδόντωση

    (σχήμα οδόντων):

    1= δύο πλευρές κοίλες, 2= δύο πλευρές

    ευθύγραμμες, 3= δύο πλευρές κυρτές,

    4= μία πλευρά κοίλη, μία πλευρά κυρτή,

    5= συνδυασμός των δύο πλευρών ευθύ-

    γραμμων και των δύο πλευρών κυρτών

    26

    076

    1. ΑΝΘΟΣ

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    εμφανές φύλο

    (αναπαραγωγικά όργανα):

    1= ανεπτυγμένοι στήμονες χωρίς γυναικεί-

    ον, 2= ανεπτυγμένοι στήμονες και υπανά-

    πτυκτο γυναικείον, 3= ανεπτυγμένοι στήμο-

    νες και αναπτυγμένο γυναικείον,

    4= γερμένοι στήμονες και αναπτυγμένο

    γυναικείον

    16

    151

    1. ΣΤΑΦΥΛΗ ΣΕ ΒΙΟΜΗΧΑΝΙΚΗ ΩΡΙΜΟΤΗΤΑ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΠΟΙΚΙΛΙΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ

    ΠΟΙΚΙΛΙΕΣ)

    8.1. φωτογραφία (με κλίμακα).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    8.2.

    σχήμα:

    1= κωνικό, 3= κωνικό προς κυλινδρικό,

    5=κυλινδρικό, 7= άλλος τύπος να περιγραφεί

    208

    8.3.

    μέγεθος

    (χωρίς τον ποδίσκο):

    1= πολύ μικρό, 3= μικρό, 5= μέτριο,

    7= μεγάλο, 9= πολύ μεγάλο

    32

    36044                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    8.4.

    ποδίσκος (μήκος):

    1= πολύ μικρό (έως 3 εκ.), 3= μικρό

    (4-5 εκ.), 5= μέτριο (6-7 εκ.), 7= μεγάλο

    (8-9 εκ.), 9= πολύ μεγάλο (μεγαλύτερο

    από 11 εκ.)

    34

    206

    8.5.

    μέσο βάρος σε γραμμά-

    ρια: λαμβάνεται το μέσο

    βάρος των μεγαλύτε-

    ρων σταφυλών από 10

    βλαστούς

    502

    8.6.

    αποράγωσις (σε 30 ρά-

    γες από το μεσαίο τμή-

    μα 10 σταφυλών, μέτρη-

    ση με δυναμόμετρο):

    1= δύσκολη, 2= μέτρια εύκολη,

    3= πολύ εύκολη.)

    38

    240

    8.7.

    πυκνότης της σταφυλής:

    1= πολύ μικρή, 3= μικρή, 5= μέτρια,

    7= μεγάλη, 9= πολύ μεγάλη

    33

    204

    1. ΡΑΓΑ ΣΕ ΒΙΟΜΗΧΑΝΙΚΗ ΩΡΙΜΟΤΗΤΑ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΠΟΙΚΙΛΙΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ

    ΠΟΙΚΙΛΙΕΣ)

    9.1. φωτογραφία (με κλίμακα).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    9.2.

    σχήμα (εξέταση 30 ρα-

    γών του μεσαίου τμήμα-

    τος 10 σταφυλών):

    1= πεπλατυσμένο, 2= σφαιρικό,

    3= μακρύ ελλειπτικό, 4= κοντό

    ελλειπτικό, 5= κυλινδρικό, 6= αμβλύ

    ωοειδές, 7= ωοειδές, 8= αντωοειδές, 9=

    τοξοειδές, 10= σχήμα δακτύλου

    36

    223

    9.3.

    πάχος με ένδειξη μέσου

    βάρους:

    1= πολύ μικρό, 3= μικρό, 5= μέτριο,

    7= μεγάλο, 9= πολύ μεγάλο

    9.4.

    χρώμα:

    1= πράσινο, 2= κίτρινο πράσινο, 3=

    κίτρινο, 4= κίτρινο ερυθρωπό, 5= ερυ-

    θρωπό, 6= ερυθρό, 7= γκρι ερυθρό, 8=

    σκούρο ερυθρό βιολετί, 9= μπλε μαύρο

    37

    225

    9.5.

    φλοιός πάχος (όσον

    αφορά τις επιτραπέζιες

    ποικιλίες):

    1= λεπτός, 2= μέτριος, 3= χονδρός

    39

    228

    9.6.

    αριθμός γιγάρτων (σχη-

    ματισμός γιγάρτων,

    όσον αφορά τις επιτρα-

    πέζιες ποικιλίες):

    1= κανένα, 2= υπανάπτυκτα, 3= πλήρη

    43

    241

    9.7.

    σάρκα (συνεκτικότητα):

    1= μαλακή ή ελαφρώς σκληρή,

    2= μετρίως σκληρή, 3= πολύ σκληρή

    41

    235

    9.8.

    χυμός:

    1= λίγο χυμώδης, 2= χυμώδης, 3= πολύ

    χυμώδης

    232

    9.9.

    άρωμα:

    1= κανένα, 2= μοσχάτο, 3= ιδιάζον

    άρωμα (foxy) που χαρακτηρίζει οίνους

    από ποικιλίες που δεν ανήκουν στο

    V. vinifera, 4= χορτώδες, 5= άλλο

    42

    236

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36045

    1. ΓΙΓΑΡΤΟ (ΟΣΟΝ ΑΦΟΡΑ ΤΙΣ ΟΙΝΟΠΟΙΗΣΙΜΕΣ ΚΑΙ ΤΙΣ ΕΠΙΤΡΑΠΕΖΙΕΣ ΠΟΙΚΙΛΙΕΣ) φωτογραφία των δύο επιφανειών και πλάγια όψη (με κλίμακα).

    ΜΕΡΟΣ Β (εθνικές διατάξεις)

    ΠΡΟΣΘΕΤΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΜΟΡΦΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ, σύμφωνα με το πρωτόκολλο για τις Δοκιμές Διακριτότητας, Ομοιομορφίας

    και Σταθερότητας του Κοινοτικού Γραφείου Φυτικών Ποικιλιών TP/050/2 (CPVO, http://cpvo.europa.eu/sites/default/

    files/documents/vitis_2.pdf ) και με την δεύτερη έκδοση του καταλόγου δεικτών για την περιγραφή των ποικιλιών της

    αμπέλου του Διεθνούς Οργανισμού για την άμπελο και τον οίνο (OIV, http://www.oiv.int/en/technical-standards-and-

    documents/description-of-grape-varieties/oiv- descriptor-list-for-grape-varieties-and-vitis-species-2nd-edition).

    α/α

    χαρακτήρας

    παρατηρήσεις

    Κωδικός

    CPVO

    Κωδικός

    OIV

    1

    Χρόνος έκπτυξης οφθαλμών (έναρξη έκπτυ-

    ξης οφθαλμών έως έκπτυξη οφθαλμών-ορα-

    τή η πράσινη κορυφή)

    1= πολύ πρώιμη, 3= πρώιμη,

    5= μέση, 7= όψιμη,

    9= πολύ όψιμη

    1

    301

    2

    Νεαρός βλαστός: έρποντα τριχίδια στην κο-

    ρυφή (ορατή ταξιανθία έως τέλος άνθησης)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια,

    7= πυκνά, 9= πολύ πυκνά

    3

    004

    3

    Νεαρός βλαστός: ένταση ανθοκυάνης των

    ερπόντων τριχιδίων στην κορυφή (όπως 2)

    1= απουσία ή πολύ ασθενής,

    3= ασθενής, 5= μέτρια,

    7= έντονη, 9= πολύ έντονη

    4

    003

    4

    Νεαρός βλαστός: όρθια τριχίδια στην κορυφή

    (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    5

    005

    5

    Νεαρό φύλλο: έρποντα τριχίδια μεταξύ των

    κύριων νεύρων στην κάτω επιφάνεια του ελά-

    σματος (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    7

    053

    6

    Νεαρό φύλλο: όρθια τριχίδια στα κύρια νεύρα

    της κάτω επιφάνειας του ελάσματος (όπως 2)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    8

    056

    7

    Βλαστός: στάση – πριν τη δημιουργία κόμβων

    (αρχή έως τέλος άνθησης)

    1= όρθια, 3= ημιόρθια, 5= ορι-

    ζόντια, 7=

    ημιπίπτουσα, 9=

    πίπτουσα

    9

    006

    8

    Βλαστός: χρώμα ραχιαίας πλευράς των μεσο-

    γονατίων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    10

    007

    9

    Βλαστός: χρώμα κοιλιακής πλευράς των με-

    σογονατίων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    11

    008

    10

    Βλαστός: χρώμα ραχιαίας πλευράς των κόμ-

    βων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    12

    009

    11

    Βλαστός: χρώμα κοιλιακής πλευράς των κόμ-

    βων (όπως 8)

    1= πράσινο, 2= πράσινο και

    κόκκινο, 3= κόκκινο

    13

    010

    12

    Βλαστός: όρθια τριχίδια στα μεσογονάτια

    (όπως 8)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    14

    012

    13

    Βλαστός: μήκος ελίκων (όπως 8)

    1= πολύ κοντό, 3= κοντό,

    5= μεσαίο, 7= μακρύ, 9= πολύ

    μακρύ

    15

    017

    36046                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    14

    Ώριμο φύλλο: μέγεθος ελάσματος (ράγες μέ-

    γεθος μπιζελιού έως περκασμό)

    1= πολύ μικρό, 3= μικρό,

    5= μέτριο, 7= μεγάλο, 9= πολύ

    μεγάλο

    17

    065

    15

    Ώριμο φύλλο: φλύκταινες στην πάνω επιφά-

    νεια του ελάσματος (όπως 14)

    1= απουσία ή πολύ ασθενείς,

    3= ασθενείς, 5= μέτριες,

    7= έντονες, 9= πολύ έντονες

    19

    075

    16

    Ώριμο φύλλο: βάθος των κορυφαίων πλευρι-

    κών κόλπων (όπως 14)

    1= απουσία ή πολύ μικρό, 3=

    μικρό, 5= μέτριο, 7= μεγάλο,

    9= πολύ μεγάλο

    21

    094

    17

    Ώριμο φύλλο (Μόνο ποικιλίες με έλλοβα φύλ-

    λα): θέση των λοβών των κορυφαίων πλευρι-

    κών κόλπων (όπως 14)

    1= ανοιχτοί, 2= κλειστοί,

    3= με ελαφρά επικάλυψη,

    4= με ισχυρή επικάλυψη

    22

    082

    18

    Ώριμο φύλλο: θέση των λοβών του μισχικού

    κόλπου (όπως 14)

    1= τελείως ανοιχτοί, 2= πολύ

    ανοιχτοί, 3= μισάνοιχτοι,

    4= ελαφρώς ανοιχτοί, 5= κλει-

    στοί, 6= με ελαφρά επικάλυψη,

    7= με μέση επικάλυψη, 8= με

    έντονη επικάλυψη, 9= με πολύ

    έντονη επικάλυψη

    23

    079

    19

    Ώριμο φύλλο: μήκος οδόντων (όπως 14)

    3= μικρό, 5= μέτριο,

    7= μεγάλο

    24

    20

    Ώριμο φύλλο: αναλογία μήκους/ πλάτους

    οδόντων (όπως 14)

    1= πολύ μικρή, 3= μικρή,

    5= μέση, 7= μεγάλη, 9= πολύ

    μεγάλη

    25

    078

    21

    Ώριμο φύλλο: αναλογία των κύριων νεύρων

    στην άνω επιφάνεια του ελάσματος με ανθο-

    κυάνη (όπως 14)

    1= απουσία ή πολύ μικρή,

    3= μικρή, 5= μέση, 7= μεγάλη,

    9= πολύ μεγάλη

    27

    22

    Ώριμο φύλλο: έρποντα τριχίδια μεταξύ κύρι-

    ων νεύρων στην κάτω επιφάνεια του ελάσμα-

    τος (όπως 14)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    28

    084

    23

    Ώριμο φύλλο: όρθια τριχίδια στα κύρια νεύρα

    της κάτω επιφάνειας του ελάσματος (όπως 14)

    1= απουσία ή πολύ αραιά,

    3= αραιά, 5= μέτρια, 7= πυκνά,

    9= πολύ πυκνά

    29

    087

    24

    Ώριμο φύλλο: μήκος μίσχου σε σχέση με το

    μήκος του κεντρικού νεύρου (όπως 14)

    1= πολύ κοντύτερο, 2= ελα-

    φρώς κοντύτερο, 3= ίσο, 4=

    ελαφρώς μακρύτερο, 5= πολύ

    μακρύτερο

    30

    093

    25

    Χρόνος έναρξης ωρίμανσης της ράγας (περ-

    κασμός)

    1= πολύ πρώιμη, 3= πρώιμη,

    5= μέση, 7= όψιμη, 9= πολύ

    όψιμη

    31

    303

    26

    Ράγα: μέγεθος

    1= πολύ μικρό, 3= μικρό,

    5= μέτριο, 7= μεγάλο, 9= πολύ

    μεγάλο

    35

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36047

    27

    Ράγα: ένταση ανθοκυάνης της σάρκας (τεχνο-

    λογική ωρίμανση)

    1= απουσία ή πολύ αδύνατη,

    3= αδύνατη, 5= μέτρια,

    7= έντονη, 9= πολύ έντονη

    40

    231

    28

    Κληματίδα: κύριο χρώμα (στάδιο ληθάργου)

    1= κιτρινωπό καφέ, 2= πορτο-

    καλί καφέ, 3= σκούρο καφέ,

    4= ερυθρωπό καφέ, 5= βιολετί

    44

    103

    1. DNA ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ (DNA ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ) σύμφωνα με την δεύτερη έκδοση του καταλόγου δεικτών

    για την περιγραφή των ποικιλιών της αμπέλου του Διεθνούς Οργανισμού για   την                       άμπελο και                                                                                                                        τον

    οίνο      (OIV,     http://www.oiv.int/en/technical-standards-and- documents/description-of-grape-varieties/oiv-

    descriptor-list-for-grape-varieties-and-vitis-species-2nd- edition): δηλώνονται από τον αιτούντα στο έντυπο που

    χορηγείται από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτική προσκόμιση αποτελεσμάτων

    από αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.

    α/α

    Mοριακός δείκτης

    (SSR- marker)

    Αλληλουχίες εκκινητών

    Κωδικός

    OIV

    1.

    VVS2

    [F]: CAGCCCGTAAATGTATCCATC

    [R]: AAATTCAAAATTCTAATTCAACTGG

    801

    2.

    VVMD5

    [F]: CTAGAGCTACGCCAATCCAA

    [R]: TATACCAAAAATCATATTCCTAAA

    802

    3.

    VVMD7

    [F]: AGAGTTGCGGAGAACAGGAT

    [R]: CGAACCTTCACACGCTTGAT

    803

    4.

    VVMD27

    [F]: GTACCAGATCTGAATACATCCGTAAGT

    [R]: ACGGGTATAGAGCAAACGGTGT

    804

    5.

    VrZAG62

    [F]: GGTGAAATGGGCACCGAACACACGC

    [R]: CCATGTCTCTCCTCAGCTTCTCAGC

    805

    6.

    VrZAG79

    [F]: AGATTGTGGAGGAGGGAACAAACCG

    [R]: TGCCCCCATTTTCAAACTCCCTTCC

    806

    7.

    VVMD32

    [F]: TATGATTTTTTAGGGGGGTGAGG

    [R]: GGAAAGATGGGATGACTCGC

    807

    8.

    VVMD25

    [F]: TTCCGTTAAAGCAAAAGAAAAAGG

    [R]: TTGGATTTGAAATTTATTGAGGGG

    808

    9.

    VVMD28

    [F]: AACAATTCAATGAAAAGAGAGAGAGAGA

    [R]: TCATCAATTTCGTATCTCTATTTGCTG

    809

    ΜΕΡΟΣ Γ΄ (ΜΕΡΟΣ Β του Παραρτήματος Ι της Οδηγίας 2004/29/ΕΚ) ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ

    1. ΒΛΑΣΤΙΚΑ ΣΤΑΔΙΑ

    1.1. Ημερομηνίες εμφανίσεως βλαστικών σταδίων

    Οι ημερομηνίες εμφανίσεως των βλαστικών σταδίων ορίζονται κατόπιν συγκρίσεως με μία ή περισσότερες από τις ακόλουθες ποικιλίες μάρτυρες.

    1.1.1. ποικιλίες λευκών σταφυλιών – Σαββατιανό (Savatiano), Ζουμιάτικο (Zoumiatiko), Βηλάνα (Vilana), Ασύρτικο

    (Assyrtiko), Chardonnay.

    1.1.2. ποικιλίες μαύρων σταφυλιών – Μανδηλαριά (Mandilaria), Ξυνόμαυρο (Xynomavro), Cabernet Sauvignon, Κορινθιακή (Korinthiaki).

    1.1.3. ποικιλίες επιτραπέζιων σταφυλιών – Ραζακί (Razaki), Cardinal, Iτάλια (Italia), Σουλτανίνα (Soultanina), Perlette.

    1.2. Ημερομηνία εκπτύξεως

    Ημερομηνία κατά την οποία εκπτύσσεται πλήρως το ήμισυ των οφθαλμών ενός πρέμνου κανονικά κλαδευμένου και φαίνεται ο εσωτερικός τους χνοασμός σε σχέση με τις ποικιλίες μάρτυρες.

    1.3. Ημερομηνία πλήρους ανθήσεως

    Ημερομηνία κατά την οποία, για ένα σύνολο φυτών, το ήμισυ των ανθέων είναι ανοικτά συγκρινόμενο με τις

    ποικιλίες μάρτυρες.

    1.4. Ωριμότης (όσον αφορά τις οινοποιήσιμες ποικιλίες και τις επιτραπέζιες ποικιλίες) Επιπροσθέτως της περιόδου

    ωριμότητος εξετάζονται η πυκνότης ή ο πιθανός βαθμός του γλεύκους, η οξύτης του και η αντίστοιχη απόδοση σε

    36048                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

    σταφυλές εκφραζομένη σε χιλιόγραμμα ανά αντίστοιχο

    εκτάριο σε σύγκριση με μιά ή περισσότερες ποικιλίες

    μάρτυρες που έχουν δώσει κατά το δυνατό αποδόσεις της αυτής τάξεως μεγέθους.

    1.5. Ημερομηνία φυλλόπτωσης

    1. ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΚΑΛΛΙΕΡΓΕΙΑΣ

    2.1. Ζωηρότης: παρατήρηση κατά την άνθηση και μετά

    την φυλλόπτωση. Οπτική εκτίμηση του μήκους και της

    διαμέτρου των κύριων βλαστών. Μέση τιμή 10 βλαστών

    κοντά στον κορμό. (Κωδικός OIV 351).

    2.2. Τρόπος μορφώσεως (θέση του πρώτου καρποφό-

    ρου οφθαλμού, προτιμώμενο κλάδεμα):
       (Κωδικός OIV 155).

    2.3. Παραγωγή

    2.3.1. κανονικότης.

    2.3.2. απόδοση:

    Α) Ποικιλίες: Μετράται η απόδοση της ποικιλίας (κιλά/

    στρ.) σε σύγκριση με μια ή περισσότερες ποικιλίες μάρ-
    τυρες. (Κωδικός OIV 504).

    Β) Υποκείμενα: Μετράται η απόδοση σε μοσχεύματα ανά στρέμμα (Κωδικός OIV 551).

    2.3.3.  ανωμαλίες: Μικροραγία (Κωδικός OIV 222), αν-

    θόροια (ποσοστό καρπόδεσης, Κωδικός OIV 501), ανισο-

    ραγία (Κωδικός OIV 222).

    2.4. Ανθεκτικότης ή ευαισθησία (δηλώνεται από τον

    αιτούντα στο έντυπο που χορηγείται από το Τμήμα Ελέγ-

    χου Ποικιλιών Καλλιεργουμένων Φυτών, με υποχρεωτι-

    κή προσκόμιση αποτελεσμάτων από αναγνωρισμένα

    εργαστήρια της χώρας ή άλλων κρατών μελών της Ε.Ε.).

    2.4.1. σε δυσμενείς συνθήκες: χλώρωση από έλλειψη

    σιδήρου (OIV 401), αλατότητα (OIV 402), ξηρασία (OIV

    403).

    2.4.2. σε επιβλαβείς οργανισμούς: περονόσπορος (OIV

    452-1), ωίδιο (OIV 455-1), βοτρύτις (OIV 458-1), ευτυπίω-

    ση (OIV 460), φυλλόβιος φυλλοξήρα (OIV 461), ριζόβιος φυλλοξήρα (OIV 462).

    2.4.3. πιθανή ευαισθησία στη σχάση των ραγών.

    2.5. Συμπεριφορά κατά τον αγενή πολλαπλασιασμό

    (δηλώνεται από τον αιτούντα στο έντυπο που χορηγείται

    από το Τμήμα Ελέγχου Ποικιλιών Καλλιεργουμένων Φυ-

    τών, με υποχρεωτική προσκόμιση αποτελεσμάτων από

    αναγνωρισμένα εργαστήρια της χώρας ή άλλων κρατών

    μελών της Ε.Ε.).

    2.5.1. εμβολιασμός (OIV 552).

    2.5.2.  πολλαπλασιασμός με μοσχεύματα (OIV 553).

    1. ΧΡΗΣΙΜΟΠΟΙΗΣΗ (δηλώνεται με το έντυπο Νο 2

    από τον αιτούντα).

    3.1. για οινοποίηση.

    3.2. για επιτραπέζια χρήση.

    3.3. για υποκείμενο.

    3.4. για βιομηχανικές χρήσεις.

    ΜΕΡΟΣ Δ (εθνικές διατάξεις)

    ΠΡΟΣΘΕΤΑ ΦΥΣΙΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΠΟΥ ΑΦΟΡΟΥΝ ΤΗΝ ΕΞΕΤΑΣΗ ΤΗΣ ΔΙΑΚΡΙΤΟΤΗΤΑΣ, ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ΚΑΙ ΤΗΣ ΣΤΑΘΕΡΟΤΗΤΑΣ ΧΡΗΣΙΜΟΠΟΙΗΣΗ

    1. Για οινοποίηση (εκτίμηση της τεχνολογικής ποιό-

    τητας): Εξετάζονται συγκριτικά με μία ή περισσότερες

    ποικιλίες μάρτυρα.

    1.1. Αναλύσεις σταφυλών:

    1. i. Σακχαροπεριεκτικότητα γλεύκους (OIV 505), ii. ογκομετρούμενη οξύτητα (OIV 506),

    1.2. Αναλύσεις οίνων (μικροοινοποίηση με κοινό πρω-

    τόκολλο):

    1. i. Αλκοολικός τίτλος,

    2. ii. ογκομετρούμενη οξύτητα, iii. pH,

    3. iv. χρωματικά χαρακτηριστικά (ένταση, απόχρωση)

    (ερυθροί οίνοι),

    1. v. ολικές ανθοκυάνες (ερυθροί οίνοι),

      vi. δείκτης ολικών φαινολών (ερυθροί οίνοι),

    vii. οργανοληπτικοί χαρακτήρες (οπτική, οσφρητική

    και γευστική αξιολόγηση οίνων).

    1. Για επιτραπέζια χρήση (επιτραπέζιες ποικιλίες):

    2.1. Αναλύσεις σταφυλών:

    1. i. Σάκχαρα (OIV 505), και

    2. ii. ογκομετρούμενη οξύτητα (OIV506).

    ΠΑΡΑΡΤΗΜΑ II

    (Παράρτημα ΙΙ της οδηγίας 2004/29/ΕΚ)
    ΕΛΑΧΙΣΤΕΣ ΠΡΟΫΠΟΘΕΣΕΙΣ ΓΙΑ ΤΗΝ ΕΚΤΕΛΕΣΗ ΤΩΝ ΕΛΕΓΧΩΝ

    1. ΟΙΚΟΛΟΓΙΚEΣ ΠΛΗΡΟΦΟΡΙΕΣ (δηλώνονται στο

    έντυπο που χορηγείται από το Τμήμα Ελέγχου Ποικιλιών

    Καλλιεργουμένων Φυτών)
       1.1. τόπος

    1.2. γεωγραφικές συνθήκες

    1.2.1. γεωγραφικό μήκος

    1.2.2. γεωγραφικό πλάτος

    1.2.3. υψόμετρο

    1.2.4. έκθεση και κλίση

    1.3.      κλιματολογικές συνθήκες

    1.4. τύπος εδάφους

    1. ΤΕΧΝΙΚΕΣ ΛΕΠΤΟΜΕΡΕΙΕΣ

    2.1. Για οινοποιήσιμες ποικιλίες και επιτραπέζιες ποι-
    κιλίες

    2.1.1. 24 πρέμνα κατά το δυνατό σε διάφορα υποκεί-
    μενα

    2.1.2. τουλάχιστον 3 έτη παραγωγής

    2.1.3. τουλάχιστον 2 τόποι που έχουν διαφορετικές

    οικολογικές συνθήκες

    2.1.4. η συγκόλληση του εμβολίου πρέπει να εξετάζε-
    ται σε τουλάχιστον 3 ποικιλίες υποκειμένων

    2.2. Για ποικιλίες υποκειμένων

    2.2.1. 5 πρέμνα με τουλάχιστον 2 τρόπους αναπτύξεως

    2.2.2. 5 έτη μετά τη φύτευση

    2.2.3. 3 διαφορετικά οικολογικά περιβάλλοντα

    2.2.4. η συγκόλληση του εμβολίου πρέπει να εξετάζε-
    ται με τουλάχιστον 3 ποικιλίες εμβολίων.

    Άρθρο 6

    Καταργούμενες διατάξεις

    (άρθρο 2 της οδηγίας 2004/29/ΕΚ)

    1. Από την έναρξη ισχύος της παρούσας απόφασης

    καταργούνται:

    α) η αριθμ. 361896/02-10-1987 απόφαση των Υφυ-

    πουργών Εθνικής Οικονομίας και Γεωργίας «Τεχνικός Κα-

    νονισμός αποδοχής ποικιλιών αμπέλου (Vitis L.)» (Β’ 566).

    Τεύχος Β’2816/16.07.2018                             ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                                            36049

    β) η αριθμ. 440756/30-12-1985 απόφαση του Ανα-
    πληρωτή Υπουργού Γεωργίας «Γενικός Τεχνικός Κα-

    νονισμός Αποδοχής Ποικιλιών των καλλιεργουμένων

    φυτικών ειδών» (Β’ 124/26-03-1986), όπως συμπλη-

    ρώθηκε με την αριθμ. 454372/30-01-1987 υπουργική

    απόφαση «Συμπλήρωση των διατάξεων του Γενικού

    Τεχνικού Κανονισμού Αποδοχής Ποικιλιών των καλλι-

    εργουμένων φυτικών ειδών» (Β’ 111) και τροποποιήθηκε

    με τις αριθμ. 320696/24-07-1987 «Τροποποίηση της με

    αριθμ. 440756/30-12-1985 απόφασης «Γενικός Τεχνικός

    Κανονισμός Αποδοχής Ποικιλιών των καλλιεργουμένων

    φυτικών ειδών» (ΦΕΚ 124/τ.Β’/26.03.1986) όπως συμπλη-

    ρώθηκε μεταγενέστερα» (Β’ 445) και 414558/22-12-2000

    «Τροποποίηση της αριθμ. 440756/30-12-1985 Υπουρ-

    γικής Απόφασης «Γενικός Τεχνικός Κανονισμός Αποδο-

    χής Ποικιλιών των καλλιεργουμένων φυτικών ειδών»

    (Β’ 124)» (Β’ 1627), ως προς το μέρος που αφορά τις ποι-
    κιλίες αμπέλου.

    1. Κάθε αναφορά στις ως άνω καταργούμενες αποφά-

    σεις θεωρείται ως παραπομπή στην παρούσα απόφαση.

    Άρθρο 7

    Έναρξη ισχύος

    Η απόφαση αυτή αρχίζει να ισχύει από τη δημοσίευσή

    της στην Εφημερίδα της Κυβερνήσεως.

    Η απόφαση αυτή να δημοσιευθεί στην Εφημερίδα της

    Κυβερνήσεως.

    Αθήνα, 22 Ιουνίου 2018

    Ο Υφυπουργός

    ΒΑΣΙΛΕΙΟΣ ΚΟΚΚΑΛΗΣ

    36050                                                                   ΕΦΗΜΕΡΙ∆Α TΗΣ ΚΥΒΕΡΝΗΣΕΩΣ                   Τεύχος Β’ 2816/16.07.2018

     
  • lithari 3:05 am on 16/07/2018 Μόνιμος σύνδεσμος |  

    ΤΗ ΕΙΝΑΙ ΤΟ ΚΡΥΠΤΟΝΟΜΙΣΜΑ …Το Κρυπτονόμισμα είναι μία peer-to-peer…Πώς να αποκτήσετε δωρεάν κρυπτονομίσματα  που θα σας αποφέρουν μεγάλα κέρδη…ΜΠΙΤΚΟΙΝ (bitcoin) ΚΑΙ ΚΡΥΠΤΟΝΟΜΙΣΜΑ: ΤΙ ??? 

    ΤΗ ΕΙΝΑΙ ΤΟ ΚΡΥΠΤΟΝΟΜΙΣΜΑ:

    …είναι ένα ψηφιακό νόμισμα το οποίο δεν υπάρχει επισήμως σε καμία φυσική μορφή, κερμάτων ή χαρτονομισμάτων.

    Δεν παράγεται από καμία συγκεκριμένη χώρα.

    Δεν ελέγχεται από καμία συγκεκριμένη τράπεζα ή κυβέρνηση.

    Η παραγωγή του, η αποθήκευσή του, η διακίνησή του, και όλες οι συναλλαγές με αυτό γίνονται αποκλειστικά σε ηλεκτρονική μορφή.

    ==================================================

    ΝΑ ΔΗΛΩΣΟΥΜΕ-ΔΗΛΩΣΗ

    Φίλοι αναγνώστες,ΤΟ ΝΑ ΑΡΜΕΓΕΙΣ ΚΑΙ ΝΑ ΣΑΛΑΓΙΑΖΗΣ ΠΡΟΒΑΤΑ ΕΙΝΑΙ ΣΧΕΤΙΚΑ ΕΥΚΟΛΟ. ΕΜΑΣ ΤΟ ΓΕΝΟΣ ΤΟΝ ΑΝΘΡΩΠΩΝ ΠΟΙΟΣ ΜΑΣ ΒΟΣΚΗ ΚΑΙ ΠΟΙΟΣ ΜΑΣ ΝΕΜΕΤΕ !!!=BY=f.b=BOSKO΄=VOSKOS

    Φίλοι αναγνώστες

    Βρίσκεστε σ΄αυτό το ιστολόγιο με δική σας ευθύνη .

    Ενδεχομένως κάτι που θα διαβάσετε εδώ μπορεί να το θεωρήσετε ύβρη ή να σας θίξει ή να σας προσβάλλει.

    Θα πρέπει να γνωρίσετε πως δεν έχουμε καμία τέτοια πρόθεση .

    Έχοντας λοιπόν αυτό υπ΄όψιν οι επιλογές σας είναι δύο :

    α) ή να φύγετε απ΄το ιστολόγιο αυτό , διακόπτοντας την ανάγνωσή του ,ώστε να αποφύγετε πιθανή προσβολή των ηθικών , θρησκευτικών ή άλλων αξιών σας , ή β) να παραμείνετε, αποδεχόμενοι πως ότι και να διαβάσετε δεν θα σας προσβάλλει καθ΄ οιονδήποτε τρόπο .

    Εμείς απ΄την μεριά μας θα προσπαθήσουμε να διαφυλάξουμε και να προβάλουμε τις πραγματικές ανθρώπινες αξίες , έχοντας πάντα ως γνώμονα την ανθρώπινη αξιοπρέπεια και την αλήθεια .

    ΕΠΙΣΗΣ:

    1.Τα δημοτικά αθάνατα δημοτικά μπορεί η δεν συμφωνούν πλήρως με τις απόψειςτου άρθρου.

    2.Επισημαίνουν ώμος στου φίλους του μπλοκ τα παρακάτω.

    3.Η ενημέρωσης-μάθηση, είναι ιερή υποχρέωση καθενός από εμάς.

    4.Η οποίες Αποψις του άρθρου εκφράζουν το συντάκτη του, ο όποιος και αναφέρετε .

    5.Την ευθύνη στα κείμενα που αναρτούνται στο

    https://boskotsopanhs.wordpress.com/ φέρει ο υπογράφων ,ή η πηγή, και δεν αποτελούν απαραίτητα θέση και άποψη του παρόντος ιστολογίου.

    6.Σκέψης, κρίση, απόψεις, επιδίωξη κάθε μορφής μήδε αυτής καθεαυτής της ατομικής προβολή, η με σκοπό αλλότριο η αλά αίτια η άλλης αίτιας, μήδε και του οικονομικού στόχου η του αυτό κάθε αυτό ως στόχο προσωπικό οικονομικό κέρδους η εκ Άλου σκοπού, η οικονομικού η μέσο η συκοφαντικής δυσφημίσεως η επιχειρηματικής δυσφημίσεως η προσπάθεια αλλοίωσης η ολικής αλλοίωσης πραγματικών περιστατικών η γεγονότων επί σκοπού παραπλάνησης, H με στόχος το προσωπικό όφελος , η το οποιοδήποτε απορρέων όφελος η κέρδος, μήδε του οικονομικού από οιαδήποτε αφορμή η σκοπό μέσο η αιτιατό η αλλοτρίωση  απαξίωση αξιών η θεσμών,  μήδε και Tου προσωπικού η ατομικού συμφέροντος επί τοu συγκεκριμένου άρθρου ουδεμία σχέση έχουν τα δημοτικά αθάνατα δημοτικά οπουδήποτε και προέρχεται και απορρέουν .-

    7.Η δημοσιοποίηση άρθρων έχει ως σκοπό μονό και μονό την ενημέρωση-μάθηση και τίποτα λιγότερο η περισσότερο.-

    8.ΕΠΙΣΗΜΑΝΣΗ

    Ορισμένα αναρτώμενα από το διαδίκτυο κείμενα ή εικόνες (με σχετική σημείωση της πηγής), θεωρούμε ότι είναι δημόσια. Αν υπάρχουν δικαιώματα συγγραφέων, παρακαλούμε ενημερώστε μας για να τα αφαιρέσουμε. Επίσης σημειώνεται ότι οι απόψεις του ιστολόγιου μπορεί να μην συμπίπτουν με τα περιεχόμενα του άρθρου. Για τα άρθρα που δημοσιεύονται εδώ, ουδεμία ευθύνη εκ του νόμου φέρουμε καθώς απηχούν αποκλειστικά τις απόψεις των συντακτών τους και δεν δεσμεύουν καθ’ οιονδήποτε τρόπο το ιστολόγιο.

    9.ΝΑ ΔΗΛΩΣΟΥΜΕ-ΔΗΛΩΣΗ ΟΤΙ¨

    ΑΠΟΛΥΤΟΣ ΚΑΝΕΝΑ ΟΙΚΟΝΟΜΙΚΟ Η ΑΛΛΟ ΟΦΕΛΟΣ ΔΕΝ ΕΧΟΥΜΕ, ΔΕΝ ΠΕΡΙΜΕΝΟΥΜΕ ΟΥΤΕ ΚΑΙ ΘΑ ΕΠΙΔΙΩΚΟΥΜΕ ΜΕΣΑ ΑΠΟ ΤΗΝ ΠΑΡΟΥΣΑΣ ΣΕΛΙΔΑ.

    ΤΕΛΕΥΤΑΙΑ ΔΕΧΟΜΑΣΤΕ ΔΙΑΦΟΡΕΣ ΑΝΑΦΟΡΕΣ ΣΧΕΤΙΚΑ ΜΕ ΤΗΣ ΔΗΜΟΣΙΕΥΣΗΣ ΚΑΜΙΑ ΑΠΟΛΥΤΟΣ ΕΠΙΣΗΜΑΝΣΗ Η ΑΛΛΗ ΕΚΛΥΣΗ Η ΑΝΑΦΟΡΑ ΔΕΝ ΓΙΝΕΤΑΙ ΑΠΟΔΕΚΤΗ ΓΙΑ ΟΙΟΝΔΗΠΟΤΕ ΛΟΓΟ Ο ΟΠΟΙΟΣ ΑΝΑΓΡΑΦΕΤΕ ΣΤΗ ΠΑΡΟΥΣΑ ΕΠΙΣΗΜΑΝΕ ΚΑΙ ΟΡΟΥΣ ΚΑΙ ΘΑ ΔΙΑΓΡΑΦΟΝΤΑΙ ΩΣ ΑΠΑΡΑΔΕΚΤΕΣ,

    ΣΑΣ ΕΥΧΑΡΙΣΤΩ.-

    […(( Διεθνές Σύμφωνο Ατομικών και Πολιτικών Δικαιωμάτων (άρθρο 19 παρ. 1, 2) Ο κάθε άνθρωπος έχει το δικαίωμα να έχει την άποψη του χωρίς καμία παρέμβαση. πρέπει να έχει το δικαίωμα ελευθερίας της έκφρασης. Aυτό περιλαμβάνει και το δικαίωμα του καθενός να αναζητά, να γράφει και να μεταδίδει οποιεσδήποτε πληροφορία και ιδέες ανεξαρτήτως, ελεύθερη έκφραση της σκέψης ανεξάρτητα από τη λογοκρισία η άδεια, δόγματα. διαφορετικών πεποιθήσεων θρησκειών, κτλ Ως εκ τούτου, δεν υπάρχει καμία ανάγκη για δυσφήμηση, επικρίσεις βωμολοχίες, είναι έγκλημα εναντίον της τιμής του καθενός…))…]

    sklabos

    http://dhmotika.listen2myshow.com
    http://dhmotika.radio12345.com
    http://dhmotika.radiostream123.com

    http://dhmotika.radiostream321.com
    http://217.147.94.171:39389/listen.pls
    http://myradiostream.com/dhmotika

    • “Οι απόψεις του ιστολόγου μπορεί να μην συμπίπτουν με τα περιεχόμενα του άρθρου”

    ======================================================

    Χρησιμοποιείται όπως τα μετρητά. Μπορείς να το στέλνεις μέσω e-mail από τον έναν στον άλλο, σχεδόν στιγμιαία, οπουδήποτε στον κόσμο.

    ΤΟ ΚΡΥΠΤΟΝΟΜΙΣΜΑ: «Μεγάλωσε» με το Ίντερνετ και αποτελεί μία μορφή χρήματος για το Ίντερνετ.

    Το Κρυπτονόμισμα είναι μία peer-to-peer αποκεντρωμένη ηλεκτρονική μορφή χρήματος η οποία βασίζεται πάνω στις αρχές της κρυπτογραφίας για την διασφάλιση του δικτύου και την επαλήθευση των συναλλαγών. Τα περισσότερα κρυπτονομίσματα κάνουν χρήση μιας Κατανεμημένης Βάσης Δεδομένων ως τον πυλώνα του συστήματος τους, το επονομαζόμενο Blockchain. Το bitcoin που παρουσιάστηκε το 2009, έγινε το πρώτο επιτυχημένο αποκεντρωμένο κρυπτονόμισμα. Λόγω της ανοικτής φύσης του λογισμικού του, επετράπη σε πολλούς προγραμματιστές να πειραματιστούν με τον κώδικά του και να τον τροποποιήσουν (forking). Έκτοτε δημιουργήθηκε μια πληθώρα νέων κρυπτονομισμάτων στα οποία έχουν γίνει προσπάθειες για να βελτιωθούν ή και να προστεθούν λειτουργίες όπως ταχύτερες συναλλαγές, μεγαλύτερη ανωνυμία κ.ά.

    Το κυριότερο χαρακτηριστικό του κρυπτονομίσματος είναι ο αποκεντρωτικός χαρακτήρας του και μέσω αυτού η ανθεκτικότητά του σε κάθε μορφής προσπάθεια για έλεγχο και παρέμβαση.

    =============================================================

    ΜΠΙΤΚΟΙΝ (bitcoin) ΚΑΙ ΚΡΥΠΤΟΝΟΜΙΣΜΑ: Φούσκα ή Πυραμίδα;

    ΜΠΙΤΚΟΙΝ (bitcoin) ΚΑΙ ΚΡΥΠΤΟΝΟΜΙΣΜΑ: Φούσκα ή Πυραμίδα;

    Αναγνώστης των άρθρων μας, πρότεινε να περιγράψουμε και να παρουσιάσουμε τα χαρακτηριστικά και την «ταυτότητα» του λεγόμενου Bitcoin.

     

    Θα προσπαθήσουμε, όσο πιο απλά γίνεται, να δώσουμε στον απλό αναγνώστη όλα τα στοιχεία που αφορούν στο Μπιτκόιν από την καθιέρωσή του μέχρι σήμερα.

    Μπιτκόιν (Bitcoin) τι είναι:

    Το Bitcoin είναι ένα ψηφιακό νόμισμα το οποίο δεν υπάρχει επισήμως σε καμία φυσική μορφή, κερμάτων ή χαρτονομισμάτων.

    Δεν παράγεται από καμία συγκεκριμένη χώρα.

    Δεν ελέγχεται από καμία συγκεκριμένη τράπεζα ή κυβέρνηση.

    Η παραγωγή του, η αποθήκευσή του, η διακίνησή του, και όλες οι συναλλαγές με αυτό γίνονται αποκλειστικά σε ηλεκτρονική μορφή.

    Χρησιμοποιείται όπως τα μετρητά. Μπορείς να το στέλνεις μέσω e-mail από τον έναν στον άλλο, σχεδόν στιγμιαία, οπουδήποτε στον κόσμο.

    «Μεγάλωσε» με το Ίντερνετ και αποτελεί μία μορφή χρήματος για το Ίντερνετ.

    Κρυπτονόμισμα και κρυπτογραφία:

    Το Bitcoin είναι ένα ίσος προς ίσον (peer-to-peer) σύστημα πληρωμών και ένα ψηφιακό συνάλλαγμα ανοιχτού κώδικα.

    Ουσιαστικά ανήκει στην κατηγορία του κρυπτονομίσματος (cryptocurrency), καθώς χρησιμοποιεί μεθόδους κρυπτογραφίας για τη δημιουργία και διαχείριση των χρημάτων, και για την επιβεβαίωση της εγκυρότητας των συναλλαγών.

    Κρυπτονόμισμα, σε γενικές γραμμές, είναι ένα νομισματικό σύστημα, που τα κύρια χαρακτηριστικά του είναι: η σταθερότητα, η ασφάλεια, η ανωνυμία, και η ιχνηλασιμότητα.

    Για να επιτευχθεί αυτό, το σύστημα χρησιμοποιεί δύο εργαλεία: την κρυπτογραφία και έναν κατάλογο δημόσιων καταχωρήσεων.

    Σε αυτόν τον κατάλογο, ο καθένας μπορεί να μάθει όλες τις λεπτομέρειες της κάθε συναλλαγής.

    Το όνομα «κρυπτο-νόμισμα» προέρχεται από το όνομα της επιστήμης «κρυπτογραφία».

    Κρυπτογραφία είναι η επιστήμη των μεθόδων κρυπτογράφησης δεδομένων.

    Υπάρχουν δύο σκοποί για τη χρήση κρυπτογράφησης.

    Ο πρώτος είναι να στέλνει μηνύματα με ασφάλεια και εχεμύθεια.

    Ο δεύτερος είναι να υπάρχει μια λύση διαφόρων προβλημάτων στον τομέα της ασφάλειας των δεδομένων και της αυθεντικότητας.

    Το Κρυπτο-νόμισμα ενσωματώνει μια ποικιλία τεχνολογιών και θεωριών που αναπτύχθηκαν από κρυπτογράφους.

    Ο κύριος στόχος αυτών είναι η δημιουργία ενός συστήματος ψηφιακού χρήματος με υψηλή ασφάλεια το οποίο θα πρέπει να είναι ανθεκτικό στη λογοκρισία και στην απάτη.

    Η δημιουργία και η λειτουργία του Μπιτκόιν:

    Το 2008, πιθανότατα με έμπνευση και αφορμή την οικονομική κρίση, έγινε η πρώτη επιστημονική δημοσίευση που περιέγραφε το Bitcoin.

    Το 2009 έκανε την πρώτη του λειτουργική εμφάνιση, με την κυκλοφορία του πρώτου πελάτη ανοιχτού κώδικα, και την δημιουργία των αντίστοιχων Bitcoins.

    Ο συγγραφέας της δημοσίευσης, και δημιουργός του αντίστοιχου λογισμικού, παρέμεινε ανώνυμος, χρησιμοποιώντας το ψευδώνυμο Satoshi Nakamoto.

    Η πραγματική ταυτότητά του, ή ακόμα και το αν πρόκειται για ένα άτομο ή για μία ομάδα, παραμένει άγνωστο μέχρι και σήμερα.

    Οι υποθέσεις σε σχέση με την ταυτότητά του αναφέρονται σε μαθηματικές ιδιοφυΐες, επιστήμονες των υπολογιστών, οικονομικούς κοινωνιολόγους με γνώσεις προγραμματισμού και ομάδες κρυπτογράφων.

    Υπάρχουν επίσης θεωρίες, όπως πχ ότι οι εταιρείες Samsung, Toshiba, Nakamichi και Motorola κρύβονται πίσω από το Bitcoin.

    Από το 2009 μέχρι και τις αρχές του 2010 το Bitcoin δεν είχε καμία απολύτως αξία.

    Τον Απρίλιο του 2010 ξεκίνησαν οι πρώτες συναλλαγές στις χρηματαγορές, με την αξία του κάθε Bitcoin να μην ξεπερνάει τα 0,14 δολάρια.

    Η πρώτη εμπορική συναλλαγή με το νέο ψηφιακό νόμισμα έγινε στις 18 Μαΐου 2010, όταν ο προγραμματιστής Laszlo Hanyecs, από την Φλόριντα των Ηνωμένων Πολιτειών, έκανε μια δημοσίευση στο Forum BitcoinTalk.org, προσφέροντας 10.000 bitcoins σε όποιον του παράγγελνε δυο πίτσες.

    Στις 22 Μαΐου, ο αγρότης David Forster από την Μασαχουσέτη, με το ψευδώνυμο Jarcos στο forum, δέχτηκε τη συναλλαγή.

    Ο Laszlo έλαβε τις δύο πίτσες από την αλυσίδα Papa John’s.

    Την άνοιξη του 2011, τα 10.000 εκείνα bitcoins θα έφταναν να αξίζουν 272.329,00 δολάρια.

    Στις αρχές Δεκεμβρίου 2013 το Bitcoin είχε φτάσει να αξίζει μεταξύ 1.200 και 1.400 δολαρίων το καθένα, κάνοντας την πίτσα εκείνη να αξίζει περίπου όσο ένα ιδιωτικό νησί.

    Στον αντίποδα, στα μέσα Δεκεμβρίου και μέσα σε λιγότερη από μία ημέρα, η αξία του bitcoin έπεσε κάτω από τα 550 δολάρια.

    Γενικά, πάντως, η αξία του Bitcoin είναι ασταθής.

    Υποστηρίζεται από πολλούς, ότι το Μπιτκόιν αποτελεί μία δύναμη εκδημοκρατισμού και μετάλλαξης του χρηματοπιστωτικού συστήματος.

    Ιστορικά, τα εθνικά νομίσματα αντέχουν κατά μέσο όρο περίπου τριάντα χρόνια, προτού κυλήσουν στον υπερπληθωρισμό, την υποτίμηση και εκεί που οι κυβερνήσεις χρησιμοποιούν τη δύναμη του νομίσματος για να δημιουργήσουν κρυμμένους φόρους μέσα από τον πληθωρισμό.

    Να αφαιρέσουν χρήματα από συνταξιούχους, αποταμιεύσεις αλλά και επενδυτές, για να καλύψουν τα χρέη τους.

    Ελάχιστα είναι τα νομίσματα που άντεξαν περισσότερο από 30 χρόνια και δεν αντιμετώπισαν τέτοια φαινόμενα.

    Το bitcoin είναι μία νέα επιλογή, μία νέα μορφή νομίσματος, ένα σύστημα νομίσματος που δεν ελέγχεται από κυβερνήσεις και λειτουργεί στο Ίντερνετ, χρησιμοποιώντας ένα διαδικτυακό πρωτόκολλο από το οποίο εξασφαλίζεται η λειτουργία του από τη συνεργασία χιλιάδων συμμετεχόντων εκ των οποίων κανένας δεν έχει τον έλεγχο.

    Δεν υπάρχει καμία κεντρική τοποθεσία, όπως άλλωστε είναι η δομή του Web και του email.

    Το Μπιτκόιν (bitcoin) έφερε την απελευθέρωση του νομίσματος στους ιδιώτες.

    Και μοιάζει να είναι μία ιδέα που προχωράει και επεκτείνεται και θα ανέβει ψηλά.

    Θα δούμε όμως ακόμη πολλές αναταράξεις, μεγάλη ένταση που θα ανεβαίνει ψηλά πολύ γρήγορα και πιθανότατα, θα πέφτει χαμηλά πολύ γρήγορα. Θα έχει πολλές διακυμάνσεις.

    Είναι ακόμη ένα μικρό νόμισμα που χρησιμοποιείται ως «καταφύγιο» για πολύ μεγάλες οικονομίες.

    Για παράδειγμα, οι Κινέζοι το χρησιμοποιούν ως μέσο αποφυγής ελέγχου των ισοτιμιών και της υποτίμησης του δικού τους νομίσματος.

    Δεν θα έπρεπε, νομίζω, κάποια χώρα να υιοθετήσει το bitcoin ως εθνικό νόμισμα.

    Η ιδέα των εθνικών νομισμάτων ως μορφή μονοπωλίου των κυβερνήσεων η οποία επιβάλλεται στους πολίτες είναι και ο λόγος που υπάρχει το χάος των ισοτιμιών των νομισμάτων σήμερα.

    Αντίθετα, το bitcoin αποτελεί μία δυνατότητα επιλογής για τους πολίτες να το υιοθετήσουν αν το επιθυμούν.

    Στην πραγματικότητα, αποτελεί το αντίθετο της επιβολής ενός κρατικού νομίσματος.

    Μήπως είναι φούσκα ή πυραμίδα;

    Μήπως όμως πρόκειται για ένα Σχήμα Πόντσι ή μία οικονομική φούσκα που σε λίγο θα σκάσει;

    O όρος «Σχήμα Πόντσι» (Ponzi Scheme) αναφέρεται σε οποιαδήποτε χρηματική απάτη στηρίζεται σε «πυραμίδα» επενδυτών.

    Η πυραμίδα επενδυτών αποτελεί ένα παράνομο επενδυτικό σχήμα που περιλαμβάνει την πληρωμή απόδοσης σε επενδυτές από τα χρήματα που πληρώνονται από μεταγενέστερους επενδυτές, αντί από τα καθαρά κέρδη που συγκεντρώνονται από πραγματικές πωλήσεις.

    Για να υπάρχει όμως ένα Σχήμα Πόντσι, θα πρέπει να υπάρχει κάποιος που να ωφελείται απευθείας από το Σχήμα Πόντσι δηλαδή την πυραμίδα.

    Εδώ όμως, δεν υπάρχει κανείς που να το ελέγχει ή να ωφελείται απευθείας από την ανάπτυξη του bitcoin, πέρα από το γεγονός ότι οι άνθρωποι που έχουν επενδύσει στο bitcoin έχουν κάτι να κερδίσουν αν γίνει δημοφιλές.

    Με αυτόν τον τρόπο, κάθε νόμισμα ευνοεί αυτούς που το υιοθέτησαν πρώτοι.

    Κάθε τεχνολογία έχει παρόμοιο μονοπάτι.

    Οι πρώτοι που το υιοθετούν, κερδίζουν τα περισσότερα, όπως οι πρώτοι άνθρωποι που υιοθέτησαν το Ιντερνέτ κέρδισαν τα περισσότερα από το Διαδίκτυο.

    Δεν μπορούμε να το θεωρήσουμε ένα Σχήμα Πόντζι ή πυραμίδα για αυτόν το λόγο.

    Αν όμως το Μπιτκόιν δεν αποτελεί πυραμίδα ή Σχήμα Πόντσι θα μπορεί να γίνει μια φούσκα.

    Δεν είναι η πρώτη άλλωστε, είναι η πέμπτη φορά που συμβαίνει.

    Ένας λόγος για τον οποίο το Bitcoin δημιουργεί αυτές τις φούσκες είναι ότι πρόκειται για ένα μικρό νόμισμα, είναι παγκόσμιας εμβέλειας, είναι πολύ ανοιχτό στις διαπραγματεύσεις και ως αποτέλεσμα έχεις αυτές τις συναισθηματικές αποκρίσεις.

    Ο κόσμος είναι ενθουσιασμένος που ανεβαίνει η τιμή και αυτό θα προκαλέσει την άνοδό του σε τιμές που δεν μπορούν να υποστηριχθούν.

    Και μετά η τιμή θα ξαναπέσει. Έχουμε δει αυτές τις μεταβολές όπου πάει γρήγορα πολύ ψηλά και με τον ίδιο τρόπο πολύ χαμηλά.

    Το μέλλον του Μπιτκόιν:

    Στο μέλλον θα δούμε, πιθανότατα, έναν κόσμο με ψηφιακά νομίσματα, ανεξάρτητα, μη κρατικά, όπως το bitcoin, αποκεντρωμένα που δεν θα ελέγχονται από κανέναν, που θα βασίζονται σε δικτυακή συνεργασία στο διαδίκτυο, με ανοιχτή πρόσβαση για όλους.

    Θα μπορέσουν, πιθανότατα, να συνυπάρξουν με επιτυχία μαζί και με τα εθνικά νομίσματα.

    Στο μέλλον θα σπάσει το μονοπώλιο των εθνικών νομισμάτων και θα δούμε αρκετά ψηφιακά νομίσματα που θα βασίζονται στη διαδικτυακή συνεργασία.

    Είτε αυτά θα είναι το bitcoin, είτε κάτι άλλο, είτε με άλλο όνομα ή με διαφορετική τεχνολογία.

    Στο μέλλον θα έχουμε εθνικά ψηφιακά νομίσματα, καθώς και ιδιωτικά ψηφιακά νομίσματα που δεν θα ελέγχονται από τράπεζες και κυβερνήσεις.

    ====================================================================

    Πώς να αποκτήσετε δωρεάν κρυπτονομίσματα  που θα σας αποφέρουν μεγάλα κέρδη

    Πριν ξεκινήσω αυτόν τον δύσκολο οδηγό που για μένα θα πρέπει όλοι όσοι ασχολούνται με το νομίσματα να τον κάνουν κτήμα τους  γιατί μόλις θα μάθετε μυστικά που μπορούν να σας δώσουν αρκετά κέρδη….  Θα αφήσω μερικές γραμμές για το τι έχει συμβεί μέχρι τώρα στην προσπάθειά μου να δημιουργήσω μία ομάδα που ασχολείται με τα κρυπτονομισματα..

    Ειναι αναγκαστικό να το κάνω  από δύο απόψεις… Πρώτον γιατί όπως σου έχω ξαναπεί το ίντερνετ είναι ένα κρεμμύδι όπου μέσα στο χρόνο διπλώνει και ξεδιπλώνει τα φύλλα του και έτσι θέλω να ενημερώσω και από αυτο το άρθρο τον αναγνώστη οποίος δεν έχει προλάβει να διαβάσει τα προηγούμενα άρθρα… και δεύτερον γιατί είναι ψυχολογική ανάγκη να εκφράσω όλα όσα εισπράττω από αυτή την διαδικασία που ξεκίνησα πριν μέρες!

    Πριν μέρες λοιπόν  έγραψα αυτό το άρθρο…(https://katohika.gr/stranger-voice/mia-symferousa-protasi-kai-gia-tous-dyo-mas-apo-ton-stranger/)  και ζήτησα συγκεκριμενα πραγματα σε όσους θέλουν να ακολουθήσουν αυτό το ταξίδι… συνήθως Όταν ένας άνθρωπος που εκτίθεται ζητάει κάτι τέτοιο δεν έχει σκοπό ούτε να γίνει ρεζίλι ούτε να δείξει ότι στο αντικείμενο που θέλει να αγωνιστεί δεν είναι όσο καλός θέλει να πιστεύει…

    Εσεις  από την άλλη όταν ο οποιοσδήποτε σας καλέσει σε μία τέτοια ενέργεια πρέπει να αναρωτηθείτε αν έχετε να κάνετε με έναν χαζούλη η με κάποιον που αξίζει  να τον ακολουθήσετε  και να ακούσετε την πληροφορία του!

    Μέχρι στιγμής συμμετέχετε 77 άτομα,  όχι άσχημα Για αρχή Αν και στόχος μου είναι τα πολλές χιλιάδες άτομα… βέβαια αυτό θα το επιτύχει η πληροφορία μου…. από τα 77 άτομα μετρημένοι στα δάχτυλα έκαναν αυτά που ζήτησα στο πρώτο άρθρο….  και ένας μόνο έκανε ό τι είπα στο δεύτερο  αρθρο….!Το δευτερο αρθρο (https://katohika.gr/stranger-voice/pos-tha-agorasete-kai-tha-metaferetai-kryptonomismata-stin-platforma-kryptonomismaton-alla-kai-alla-poly-simantika/)

    Δεν σας έκρυψα ότι αυτό το κάνω γιατί πλέον αποφάσισα ότι το δωρεάν δεν το σέβεται κανείς…. Ούτε σας έκρυψα ποτέ οτι δεν θέλω να έχω απολαβές για αυτό που κάνω….

    Θα συνεχίσω να το κάνω και θα δώσω την πληροφορία που πιστεύω ότι όχι μόνο αξίζει Αλλά προσωπικά εγώ έχω πληρώσει χιλιαδες ευρώ και έχω σπαταλήσει εκατοντάδες ώρες να σπάσω το κεφάλι μου όπως και πολλά χρόνια εμπειρίας μου σε αυτό το ταξίδι από το παρελθόν…για να την αποκτησω!…Τωρα αν συνεχίσεται  την κλασική  νοοτροπία  των ανθρώπων που δεν θέλω πια να έχω σχέση….  την εξυπνάδα  του να μην σέβεστε  τις συμφωνίες μας κρατάω πάντα το δικαίωμα να ξεχωρίσω ποιοι πραγματικά τήρησαν τη συμφωνία μας…. Άρα όσοι από σας Στείλατε  Email  με ψεύτικους κωδικούς Και διάφορες άλλες δικαιολογίες…. σας Το λέω ξεκάθαρα θα σας χαρίσω το τυρί τις πληροφορίας απλά για να σας κάνω να καταλάβετε τι Θα χάσετε όταν θα σταματήσω  να σας δίνω πρόσβαση σε αυτή την πληροφορία! Νομίζω ότι ήμουνα απόλυτα ξεκάθαρος…

    Ας πάμε τώρα να δούμε με ποιον τρόπο μπορούμε να αποκτήσουμε δωρεάν κρυπτονομίσματατα οποία μπορούν να μας αποφέρουν πολύ μεγάλα  κέρδη..

    Μπορεί να σας φαίνεται παράξενο αλλά στην Αμερική υπάρχουν μεγάλες ομάδες οι οποίες ασχολούνται αποκλειστικά με αυτό και μάλιστα χιλιάδες άνθρωποι έχουν βγάλει χιλιάδες δολαρια με το να κυνηγούν και να βρίσκουν δωρεάν κρυπτονομίσματα..

    Το δωρεάν είναι δωρεάν… δωρεάν Δεν σημαίνει Δώσε 5 ευρώ… δωρεάν σημαίνει μηδέν… και ναι υπάρχει τρόπος και τακτική να ασχοληθείς με αυτό full time και να έχεις επιτυχία τεράστια!

    Αλλά ας αρχίσω τις εξηγήσεις τις πιο τεχνικές για να καλύψω τις όποιες ερωτήσεις δημιουργούνται μέσα σας και μόλις τελείωσω Με αυτές  Να σας δείξω.. μπακάλικα… βήμα βήμα.. με ποιον τρόπο μπορείτε να το πετύχετε.

    Πριν μπούμε στα τεχνικά  το συγκεκριμένο μοντέλο… ο συγκεκριμένος στίβος του δωρεάν νομίσματος… σας υπόσχομαι θα τον φέρω σε σημείο διδακτορικου….  για την ώρα θα σας δώσω μικρούς οδηγούς για το πώς μπορείτε να το κάνετε αλλά ετοιμάζω ολόκληρη διατριβή για όποιον θέλει να ακολουθήσει αυτόν τον τρόπο ασχολιας με τα κρυπτονομισματα… σε βαθμό επαγγελματισμού!

    Τι είναι τα airdrops;

    Τα airdrops είναι κρυπτονομισματα που δινονται δωρεάν στην αγορα. Τα project καθε νεου κρυπτονομισματος που μόλις ξεκινούν συχνά θα δώσουν ένα μικρό ποσό ελεύθερων μαρκών σε επαληθευμένους ανθρώπους, προκειμένου να διαδώσουν τη υπαρξη τους για το έργο τους.

    Το κανουν συχνά αυτό κοντά στην ώρα της απευλευθερωσης του ICO. Αυτό γίνεται για να διευκολυνθεί η ανάπτυξη των χρηστών και να δοθούν κίνητρα στους ανθρώπους να ενημερώσουν τους γυρω τους για το έργο (συχνά μέσω συστημάτων παραπομπής ή προώθησης κοινωνικού επιμερισμού).

    Τα airdrops εμφανίζονται υπό διάφορες μορφές, όπως: μαζική πιστωση στα πορτοφόλια (για παράδειγμα, όλα τα πορτοφόλια της NEO θα λάβουν x ποσό του ταδε νομισματος) και δωρεάν μάρκες κατά τη συμμετοχή στην κοινότητα ή την εγγραφή για κάτι η την παροχή ορισμένων βασικών προσωπικών πληροφοριών.

    Συνήθως το ποσό που παρέχεται κατά τη διάρκεια των airdrops είναι μικρό από την άποψη του κανονικου νομισματος fiat πχ δολαριο η ευρω, αλλά εάν κρατάτε τα κρυπτο για μεγάλο χρονικό διάστημα και επιλέγετε ένα καλό project, αυτά μπορούν να αυξησουν την αξία τους, καθιστώντας το ποσό σας πολυ υψηλο σε χρηματικό ποσό. Τα project που δοθηκαν δωρεαν πριν από μερικούς μήνες μπορεί να είναι σημερα αξίας $ 100 δολάριων , λόγω της ανατίμησης των τιμών.

    Εξαρτάται τελικά από το αν κρατάτε τα κρυπτο ή τα πουλάτε γρηγορα για ευκολο μικρο κερδος, αλλά σημειώστε ότι πολλά δωρεαν νομίσματα δεν θα εισαχθούν αμεσα σε μια ανταλλαγή κατά τη διάρκεια ενος airdrop, επομένως συνήθως θα πρέπει να περιμένετε κάποιο χρόνο για να τα πουλήσετε.

    Εάν αναρωτιόσαστε ακριβώς πώς είναι ευεργετικό για μια εταιρια να κάνει μαζικά airdrops κατά τη διάρκεια ενός ICO, ουσιαστικά θα πρεπει να σκεφτειτε τα εφέ του δικτύου και τη φύση των γραφημάτων του δικτύου. Θεωρίες όπως ο νόμος του Reed εχουν εξηγησει ότι η χρησιμότητα ενός δικτύου (που μετριέται με χρήματα που κερδίζονται ή οποιαδήποτε άλλη μέτρηση) είναι υπερβολικά ανάλογη με τον αριθμό των κόμβων (ανθρώπων) στο γράφημα.

    Το ακριβές ποσό χρησιμότητας κυμαίνεται από n2 έως 2 ^ n με βάση το πεδίο στο οποίο εφαρμόστηκε το γράφημα δικτύου, αλλά είναι σαφές ότι η αύξηση του δικτύου όλο και περισσοτερων ανθρωπων θα δώσει μεγάλη χρησιμότητα σε σχέση με την προηγούμενη θεση του στο δικτυο. Για παράδειγμα, αυτές οι θεωρίες δείχνουν ότι η αύξηση από 100 σε 200 άτομα θα προσφέρει σημαντικά λιγότερη πρόσθετη χρησιμότητα από ό, τι η ανάπτυξη από 1.000 έως 1.100 άτομα, αν και και το δικτυο θα εχει αποκτήσει τον ίδιο αριθμό ανθρώπων.

    Στο πλαίσιο ενός ICO, αυτό σημαίνει ότι μια σκληρή προώθηση για την επέκταση της παρουσίας του στο κοινωνικο δικτύο που θα μιλαει για το έργο του κατά τη διάρκεια της αρχης του ICO θα προσφέρει μεγάλες αποδόσεις τόσο από την άποψη των εισφορών του ICO όσο και από την περαιτέρω συμμετοχή του δικτυου στο έργο, γι ‘αυτό το λόγο αξιοποιουν καλύτερα την στιγμή στον κύκλο ζωής του έργου, ώστε να μεγιστοποιηθεί τόσο η χρηματοοικονομική όσο και η κοινοτική υποστήριξη.

    Υποθέτοντας ότι μια ομάδα έχει ένα πεπερασμένο αριθμό μοναδων που μπορει να δωθουν δωρεαν, έχει νόημα να τα χρησιμοποιήσει ειδικά κατά τη διάρκεια της ICO δηλαδη στην αρχη της υπαρξης του, σε αντίθεση με άλλες φορές, επειδή αυτα μπορούν να τα μετατρεψουν άμεσα σε χρήματα καθώς και κοινωνική επιρροή, ενώ κανονικά, αυτό θα είναι περιορισμένο σε μια απλη κοινωνική επιρροή που θα ερθει μεσα στο χρονο (και ίσως έμμεση η εκτίμηση της τιμολογιακής τιμής εάν αυξηθεί η ζήτηση).

    Επιπλέον, η διανομή ελεύθερων μαρκών δημιουργεί μια ομάδα κατόχων του κρυπτονομισματος που επικεντρώνονται περισσότερο στην πραγματική χρησιμότητα του συμβολου και στο έργο του παρα από την τιμή του(αφού δεν πληρώνουν τίποτα). Αυτό μπορεί να αποτελέσει ουσιαστικό παράγοντα για την προώθηση της υιοθεσίας και τη δημιουργία μιας αρχικής βάσης πιστών χρηστών ή / και προγραμματιστών.

    Πώς να βρείτε airdrops;

    Υπάρχουν μερικοί απλοι τρόποι για να βρείτε airdrops και μερικοι πιο συνθετοι ( Κατηγορια πρωταθλητης χαρ χαρ ). Ενας απο αυτους είναι το Bitcointalk, ένα από τα παλαιότερα και μεγαλύτερα φόρουμ για κρυπτογραφική συζήτηση. Αυτό είναι συνήθως η πρώτη θέση που θα ανακοινώσει ένα νέο έργο και είναι ένα εξαιρετικό μέρος για να μάθετε για όλους τους ΜΚΟ που υπαρχουν. Μπορείτε συνήθως να αποκτήσετε ένα μεγάλο ιστορικό του έργου, κοιτάζοντας το αρχικό νήμα του Bitcointalk. Να γνωρίζετε ότι το φόρουμ αυτό, παράλληλα με μια μεγάλη πηγή πληροφόρησης, τείνει να εχει ενα πολύ μεγάλο όγκο πληροφοριας και δεν κάνει τίποτα για να φιλτράρει προγράμματα χαμηλής ποιότητας – έτσι υπάρχουν πολλοί κρυμμένοι πολύτιμοι λίθοι εδώ, αλλα υπάρχουν ίσοι αριθμοί σχεδίων απάτης.

    Ένας άλλος κοινός τρόπος για να βρείτε airdrops είναι μέσω των διαφόρων site που ειναι ειδικευμενα για αυτη την εργασια. Αυτά συχνά κάνουν κάποια προεπεξεργασία για εσάς και βεβαιώνεστε ότι τα airdrops είναι νόμιμα και ότι τα project είναι πιθανό να πληρώσουν πραγματικά τα κέρματά σας. Για να τα κερδισετε αυτά συχνά απαιτειτε συμμετοχή σε μια ομάδα κοινωνικης δυκτιωσης ή σε ενα λογαριασμό στο Twitter. Καποιοι καλοί λογαριασμοί και ιστότοποι που μπορειτε να ακολουθήσετε ή να εγγραφειτε σε αυτά για τα airdrops ειναι οι εξής:

    https://airdropalert.com.

    Twitter Λογαριασμοι για airdrops https://twitter.com/cryptoairdrops?lang=en

    Καποια Reddit που κανουν το ιδιο https://www.reddit.com/r/airdrops/ και https://www.reddit.com/r/CryptoAirdrop/.

    Πάμε τώρα βήμα βήμα και με απλά λόγια  να κάνουμε τις σωστές κινήσεις ώστε να μπούμε σε αυτή την αρένα με τον πιο έξυπνο τρόπο…

    Καταρχάς αν κάνετε μία έρευνα στα παραπάνω link θα δειτε πολύ εύκολα οτι αν ακολουθήσετε τα airdrops που δίνουν οι  συγκεκριμένοι  αμέσως αμέσως μαζεύεται ένα ποσό καθόλου ευκαταφρόνητο να το βγάλεις μέσα σε μία ώρα από τον υπολογιστή σου… Χωρίς βέβαια να υπολογίσω ότι αν κρατήσεις αυτά τα νομίσματα έχεις μεγάλες πιθανότητες μέσα στο βάθος του χρόνου κάποια από αυτά να κάνει ένα ράλι και να σου αφήσει χιλιάδες ευρώ!Αλλα υπαρχουν πολλα αλλα ακομα…

    Ξεκινάω με τον απλό οδηγό και τελειώνοντας αυτόν τον οδηγό σας δίνω δυο τρια καλά μπόνους  που θα ενισχύσουν το πιπέρι και το αλατι σε αυτό το όμορφο φαγητό που φτιάχνουμε..

    Mέθοδος  νούμερο ένα (απλή αλλά αν δεν γνωρίζεις τον τρόπο γίνεται δυσκολη)

    Δωρεάν νομίσματα απο τα πορτοφόλια

    Για να λάβετε airdrops απο καποιο projetc, χρειάζεστε ένα πορτοφόλι που σχετίζεται με αυτό το blockchain.

    Για παράδειγμα, τα νέα προγράμματα κρυπτογράφησης μπορούν να εκμεταλλευτούν μια υπάρχουσα πλατφόρμα όπως το Ethereum για τη δημιουργία μαρκών. Συγκεκριμένα, αυτά τα νομίσματα με βάση το Ethereum ονομάζονται μάρκες ERC-20. Όταν ξεκίνησε η δημοφιλής OMG με το ERC-20, στο πλαίσιο της προώθησής της, εστειλε  airdrops της OMG σε οποιονδήποτε με πορτοφόλι Ethereum.

    Η δύσκολη απόφαση εδώ είναι με ποιον τρόπο θα αποφασίσεις να κατεβάσεις  πορτοφόλια,  Ποια από αυτά Θα κατεβάσεις;  με ποιον τρόπο θα βάλεις έστω και ένα κρυπτοσεντς μέσα  Μιας και ο νόμος λέει ότι για να δεχτείς airdrop  το πορτοφόλι δεν πρέπει να είναι 0… και γενικά να έχεις το άγχος να χειρίζεσαι στον υπολογιστή σου η σε στικάκια  εκατοντάδες  ηλεκτρονικά πορτοφόλια που όλα θα χρειάζονται και ενα κρυπτογράφημα τεράστιο σαν συνθηματικό να το έχεις αποθηκεύσει σωστά και με απόλυτη οργάνωση να ορίζεις Ποιο είναι τι!

    Αν θες να το δοκιμάσεις Κανείς δεν σε εμποδίζει…  μπορείς να πας στην CoinMarketCap  η στην https://bitscreener.Com/ να ξεκινήσεις να  φίλτραρεις  πορτοφόλια να βρίσκεις τη σελίδα του κάθε νομίσματος και να ξεκινήσεις να κατεβάζεις από το καθένα ξεχωριστά!  θα καταλήξεις σε ένα κυκεώνα  γιατί Υπάρχουν χιλιάδες πια!

    Αλλά υπάρχει και η εύκολη μέθοδος

    Κατεβάζεις το πορτοφόλι  από το https://www.Myetherwallet.Com/

    Η πλειοψηφία των νέων κρυπτονομισματων είναι κατασκευασμένη από το Ethereum και το myetherwallet είναι το πιο δημοφιλές και υποστηριζόμενο πορτοφόλι ιστού του Ether που θα μεγιστοποιήσει τις πιθανότητες να αποκτήσετε δωρεάν νομισμματα.

    Γραφεσαι στην coinbase μεσα απο το αφφιλιατε λινκ το δικο μου https://www.coinbase.com/join/52a591475db5b38393000038 και ετσι και εσυ κερδιζεις 10 δολαρια και εγω κερδιζω δεκα δολαρια…(Οταν θα μεταφερεις χρηματα στην coinbase θα σου δωσει και τα δεκα δολαρια που σε συνεστησα και βεβαια μετα μπορεις και εσυ να συστησεις αλλους κοκ)   αυτά τα δεκα τα κάνεις Ethereum η οχι αναγκαστικα τα δεκα αλλα ενα χιλιοστο και τα μεταφέρεις στο Myetherwallet ..ξανα το λεω έστω και ένα χιλιοστό ώστε το πορτοφόλι να μην είναι 0…. και περιμένεις να σου έρχονται τα ιπτάμενα νομίσματα δωρεάν!

    Το ίδιο μπορείς να ακολουθήσεις και με άλλες πλατφόρμες blockchain  όπως είναι το  NEO και Stellar

    Μέθοδος 2: Κερδίστε δωρεάν crypto σαν κυνηγος για airdrops & μπόνους

    ..Όπως εξήγησα παραπάνω οι εταιρείες δίνουν ελεύθερα νομίσματα  για να δημιουργήσουν μία μεγαλύτερη βάση από χρήστες οι οποίοι θα συναλλάσσονται με αυτά τα νομίσματα γιατί με αυτό τον τρόπο καταφέρνουν να δώσουν περισσότερη αξία στο δίκτυό τους…

    Για αυτό θα βρείτε σε όλο το ίντερνετ προτάσεις όπως πες μας την άποψή σου για αυτό το group μουσικής και θα σου δώσουμε τόσα ελεύθερα νομίσματα,   κάνε εγγραφή με το e-mail σου και βάλε και το πορτοφόλι σου στην κοινότητά μας και θα πάρεις τόσα νομίσματα…. και δεν έχει τελειωμό η διαδικασία του μάρκετινγκ ώστε να φαίνεσαι και εσύ ότι ανήκεις στη βάση ενός νομίσματος!

    Ολα αυτά για να τα καταφέρεις θα πρέπει να είσαι συνέχεια πάνω από το ίντερνετ  να ακολουθείς συζητήσεις και λογαριασμούς στο Twitter που σου δωσα παραπάνω και να τουφεκας Σαν κυνηγός  την κατάλληλη Ευκαιρία η την κατάλληλη πέρδικα!

    Κανείς δεν σου λέει να μην το κάνεις… Μάλιστα σου έχω ήδη δώσει link που αν αυτή τη στιγμή θέλεις πας και κάνεις ότι σου λένε και αρχίζεις και εισπράττεις….  αλλά είναι τόσα πολλά… είναι τόσα πολλά τα άχρηστα…. τόσα πολλά τα τσάμπα… που στο τέλος θα μπλεχτείς και θα χάσεις πολύ χρόνο!

    Υπάρχει καλύτερη λύση και σε αυτό…

    Γράφεσαι στην https://earn.Com/stranger11/referral/?A=oqyui7cc4isd9cya  με το συγκεκριμένο link ώστε να κερδίζω σε Bitcoin 1 δολάριο για κάθε νεο μελος που θα  στείλω να κερδίζει δωρεάν νομίσματα…. Δηλώνεις ότι είσαι web designer η Bitcoin buyer  και Σε πληρώνουν σε κρυπτονομισματα για να διαβάζεις διαφημιστικά μηνύματα από επιχειρήσεις. Όπως καταλαβαίνεις επειδή έχουν να κάνουν με κρυπτονομίσματα αυτά που σου στέλνουν να διαβάσεις σαν διαφημιστικά μηνύματα  μέσα θα έχουν ανακοινώσεις ξεκινήματος  σε νέα project… Όπου επί της ουσίας εσύ Αυτά ψάχνεις για να πας να πάρεις και άλλα δωρεάν νομίσματα!!

    Επί της ουσίας όλος αυτός ο οδηγός σου δείχνει έμπρακτα τρόπους με τους οποίους μπορείς να κερδίσεις χρήματα από το πουθενά…  εγώ Γνωρίζω πολύ καλά ότι οι Αμερικανοί  που ασχολούνται με τα κρυπτονομισματα αυτά τα κάνουν καθημερινά για πλάκα…. το θεωρούν κάτι το οποίο πρέπει να συμβεί….  δεν γνωρίζω αν η ίδια φιλοσοφία μπορεί να λειτουργήσει και στην ψυχοσύνθεση του Έλληνα…. γνωρίζω όμως πολύ καλά ότι υπάρχουν χιλιάδες Αμερικανοί που με αυτό τον τρόπο έχουν κερδίσει χιλιάδες ευρώ…. και αν θυμάμαι καλά Εμείς όλοι βρισκόμαστε σε μία οικονομική κρίση εξαντλητική….  εγώ θεώρησα σωστό αυτό τον οδηγό να τον δώσω ελεύθερα… χωρίς συνθηματικό για όλους!

    Δεν σου μίλησα για faucets,  δεν σου έδωσα παιδικη πληροφορία για το πως θα κερδίσεις δωρεάν κρυπτονομισμα σου έδωσα αυτό που υπάρχει αυτή τη στιγμή παγκόσμια…. και αυτό θα φροντίσω να κάνω  για όλους τους φίλους που συμμετέχουν στο ταξίδι μας για τα κρυπτονομισματα… Μάλιστα σκοπεύω να ανεβάσω πολύ το επίπεδο… να το πάω για πρωτάθλημα…. ο μόνος τρόπος που θα με κάνει να μην θέλω ξανά να συνεχίσω είναι να μου αποδείξεις ότι συνεχίζεις να μη σέβεσαι την πληροφορία που σου δίνω…. σε παρακαλώ άγνωστε φίλε μου μην το κάνεις γιατί με αυτό τον τρόπο θα επηρεάσεις και όλους αυτούς που έμαθαν να τηρούν τις συμφωνίες και τους λόγους τους!

    Ελπίζω να σας φανεί χρήσιμο και κερδοφόρο αυτό το άρθρο…. μέσα από την καρδιά μου θα θελα σε μερικούς μήνες να γνωρίζω ότι κάποιοι συνάνθρωποί μου κατάφεραν να κερδίσουν Από το τίποτα κάτι καλό…. θα εκτιμούσα ιδιαίτερα αν η πληροφορία σας φάνηκε χρήσιμη  να τη διαμοιράσεται και σε άλλους φίλους σας για να μπορέσουν να την εκμεταλλευτούν..!

    Σας Ευχαριστω για τον χρόνο σας ..

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Απάντηση
e
Αλλαγή
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Ακύρωση